- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
Sample Application
- • Animal health test
- • In-vitro diagnostics
- • Food & Feed Safety
- • Environmental Safety
- • New drug discovery
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Human ESR2/ER-BETA/ Erb ORF/cDNA clone-Lentivirus plasmid (NM_001437)
Pre-made Human ESR2/ER-BETA/ Erb Lentiviral expression plasmid for ESR2 lentivirus packaging, ESR2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to ESR2/ER-BETA products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
|---|---|---|---|
| pGMLP001497 | Human ESR2 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
| GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
| High Quality (HQ) Grade | |||
| Seed | 5ug |
Product Description
| Catalog ID | pGMLP001497 |
| Gene Name | ESR2 |
| Accession Number | NM_001437 |
| Gene ID | 2100 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 1593 bp |
| Gene Alias | ER-BETA, Erb, ESR-BETA, ESRB, ESTRB, NR3A2 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| Sequence | ATGGATATAAAAAACTCACCATCTAGCCTTAATTCTCCTTCCTCCTACAACTGCAGTCAATCCATCTTACCCCTGGAGCACGGCTCCATATACATACCTTCCTCCTATGTAGACAGCCACCATGAATATCCAGCCATGACATTCTATAGCCCTGCTGTGATGAATTACAGCATTCCCAGCAATGTCACTAACTTGGAAGGTGGGCCTGGTCGGCAGACCACAAGCCCAAATGTGTTGTGGCCAACACCTGGGCACCTTTCTCCTTTAGTGGTCCATCGCCAGTTATCACATCTGTATGCGGAACCTCAAAAGAGTCCCTGGTGTGAAGCAAGATCGCTAGAACACACCTTACCTGTAAACAGAGAGACACTGAAAAGGAAGGTTAGTGGGAACCGTTGCGCCAGCCCTGTTACTGGTCCAGGTTCAAAGAGGGATGCTCACTTCTGCGCTGTCTGCAGCGATTACGCATCGGGATATCACTATGGAGTCTGGTCGTGTGAAGGATGTAAGGCCTTTTTTAAAAGAAGCATTCAAGGACATAATGATTATATTTGTCCAGCTACAAATCAGTGTACAATCGATAAAAACCGGCGCAAGAGCTGCCAGGCCTGCCGACTTCGGAAGTGTTACGAAGTGGGAATGGTGAAGTGTGGCTCCCGGAGAGAGAGATGTGGGTACCGCCTTGTGCGGAGACAGAGAAGTGCCGACGAGCAGCTGCACTGTGCCGGCAAGGCCAAGAGAAGTGGCGGCCACGCGCCCCGAGTGCGGGAGCTGCTGCTGGACGCCCTGAGCCCCGAGCAGCTAGTGCTCACCCTCCTGGAGGCTGAGCCGCCCCATGTGCTGATCAGCCGCCCCAGTGCGCCCTTCACCGAGGCCTCCATGATGATGTCCCTGACCAAGTTGGCCGACAAGGAGTTGGTACACATGATCAGCTGGGCCAAGAAGATTCCCGGCTTTGTGGAGCTCAGCCTGTTCGACCAAGTGCGGCTCTTGGAGAGCTGTTGGATGGAGGTGTTAATGATGGGGCTGATGTGGCGCTCAATTGACCACCCCGGCAAGCTCATCTTTGCTCCAGATCTTGTTCTGGACAGGGATGAGGGGAAATGCGTAGAAGGAATTCTGGAAATCTTTGACATGCTCCTGGCAACTACTTCAAGGTTTCGAGAGTTAAAACTCCAACACAAAGAATATCTCTGTGTCAAGGCCATGATCCTGCTCAATTCCAGTATGTACCCTCTGGTCACAGCGACCCAGGATGCTGACAGCAGCCGGAAGCTGGCTCACTTGCTGAACGCCGTGACCGATGCTTTGGTTTGGGTGATTGCCAAGAGCGGCATCTCCTCCCAGCAGCAATCCATGCGCCTGGCTAACCTCCTGATGCTCCTGTCCCACGTCAGGCATGCGAGTAACAAGGGCATGGAACATCTGCTCAACATGAAGTGCAAAAATGTGGTCCCAGTGTATGACCTGCTGCTGGAGATGCTGAATGCCCACGTGCTTCGCGGGTGCAAGTCCTCCATCACGGGGTCCGAGTGCAGCCCGGCAGAGGACAGTAAAAGCAAAGAGGGCTCCCAGAACCCACAGTCTCAGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T80896-Ab | Anti-ESR2 monoclonal antibody |
| Target Antigen | GM-Tg-g-T80896-Ag | ESR2 protein |
| ORF Viral Vector | pGMLV000848 | Human ESR2 Lentivirus plasmid |
| ORF Viral Vector | pGMLP001497 | Human ESR2 Lentivirus plasmid |
| ORF Viral Vector | vGMLV000848 | Human ESR2 Lentivirus particle |
| ORF Viral Vector | vGMLP001497 | Human ESR2 Lentivirus particle |
Target information
| Target ID | GM-T80896 |
| Target Name | ESR2 |
| Gene ID | 2100, 13983, 574110, 25149, 101086317, 403639, 281146, 100033964 |
| Gene Symbol and Synonyms | er,ER-BETA,Erb,Erb2,ERbeta,ER[b],ESR-BETA,ESR2,ESRB,ESTRB,NR3A2,ODG8 |
| Uniprot Accession | Q92731 |
| Uniprot Entry Name | ESR2_HUMAN |
| Protein Sub-location | Introcelluar Protein |
| Category | Therapeutics Target |
| Disease | Cancer |
| Gene Ensembl | ENSG00000140009 |
| Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a member of the family of estrogen receptors and superfamily of nuclear receptor transcription factors. The gene product contains an N-terminal DNA binding domain and C-terminal ligand binding domain and is localized to the nucleus, cytoplasm, and mitochondria. Upon binding to 17beta-estradiol or related ligands, the encoded protein forms homo- or hetero-dimers that interact with specific DNA sequences to activate transcription. Some isoforms dominantly inhibit the activity of other estrogen receptor family members. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been fully characterized. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
Facebook
LinkedIn
Twitter
