Human FKRP/LGMD2I/MDC1C ORF/cDNA clone-Lentivirus plasmid (NM_024301)

Cat. No.: pGMLP001501
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human FKRP/LGMD2I/MDC1C Lentiviral expression plasmid for FKRP lentivirus packaging, FKRP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to FKRP/LGMD2I products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $716.64
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001501
Gene Name FKRP
Accession Number NM_024301
Gene ID 79147
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1488 bp
Gene Alias LGMD2I,MDC1C,MDDGA5,MDDGB5,MDDGC5
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCGGCTCACCCGCTGCCAGGCTGCCCTGGCGGCCGCCATCACCCTCAACCTTCTGGTCCTCTTCTATGTCTCGTGGCTGCAGCACCAGCCTAGGAATTCCCGGGCCCGGGGGCCCCGTCGTGCCTCTGCTGCCGGCCCCCGTGTCACCGTCCTGGTGCGGGAGTTCGAGGCATTTGACAACGCGGTGCCCGAGCTGGTAGACTCCTTCCTGCAGCAAGACCCAGCCCAGCCCGTGGTGGTGGCAGCCGACACGCTCCCCTACCCGCCCCTGGCCCTGCCCCGCATCCCCAACGTGCGTCTGGCGCTGCTCCAGCCCGCCCTGGACCGGCCAGCCGCAGCCTCGCGCCCGGAGACCTACGTGGCCACCGAGTTTGTGGCCCTAGTACCTGATGGGGCGCGGGCTGAGGCACCTGGCCTGCTGGAGCGCATGGTGGAGGCGCTCCGCGCAGGAAGCGCACGTCTGGTGGCCGCCCCGGTTGCCACGGCCAACCCTGCCAGGTGCCTGGCCCTGAACGTCAGCCTGCGAGAGTGGACCGCCCGCTATGGCGCAGCCCCCGCCGCGCCCCGCTGCGACGCCCTGGACGGAGATGCTGTGGTGCTCCTGCGCGCCCGCGACCTCTTCAACCTCTCGGCGCCCCTGGCCCGGCCGGTGGGCACCAGCCTCTTTCTGCAGACCGCCCTTCGCGGCTGGGCGGTGCAGCTGCTGGACTTGACCTTCGCCGCGGCGCGCCAGCCCCCGCTGGCCACGGCCCACGCGCGCTGGAAGGCTGAGCGCGAGGGACGCGCTCGGCGGGCGGCGCTGCTCCGCGCGCTGGGCATCCGCCTAGTGAGCTGGGAAGGCGGGCGGCTGGAGTGGTTCGGCTGCAACAAGGAGACCACGCGCTGCTTCGGAACCGTGGTGGGCGACACGCCCGCCTACCTCTACGAGGAGCGCTGGACGCCCCCCTGCTGCCTGCGCGCGCTGCGCGAGACCGCCCGCTATGTGGTGGGCGTGCTGGAGGCTGCGGGCGTGCGCTACTGGCTCGAGGGCGGCTCACTGCTGGGGGCCGCCCGCCACGGGGACATCATCCCATGGGACTACGACGTGGACCTGGGCATCTACTTGGAGGACGTGGGCAACTGCGAGCAGCTGCGGGGGGCAGAGGCCGGCTCGGTGGTGGATGAGCGCGGCTTCGTATGGGAGAAGGCGGTCGAGGGCGACTTTTTCCGCGTGCAGTACAGCGAAAGCAACCACTTGCACGTGGACCTGTGGCCCTTCTACCCCCGCAATGGCGTCATGACCAAGGACACGTGGCTGGACCACCGGCAGGATGTGGAGTTTCCCGAGCACTTCCTGCAGCCGCTGGTGCCCCTGCCCTTTGCCGGCTTCGTGGCGCAGGCGCCTAACAACTACCGCCGCTTCCTGGAGCTCAAGTTCGGGCCCGGGGTCATCGAGAACCCCCAGTACCCCAACCCGGCACTGCTGAGTCTGACGGGAAGCGGCTGA
ORF Protein Sequence MRLTRCQAALAAAITLNLLVLFYVSWLQHQPRNSRARGPRRASAAGPRVTVLVREFEAFDNAVPELVDSFLQQDPAQPVVVAADTLPYPPLALPRIPNVRLALLQPALDRPAAASRPETYVATEFVALVPDGARAEAPGLLERMVEALRAGSARLVAAPVATANPARCLALNVSLREWTARYGAAPAAPRCDALDGDAVVLLRARDLFNLSAPLARPVGTSLFLQTALRGWAVQLLDLTFAAARQPPLATAHARWKAEREGRARRAALLRALGIRLVSWEGGRLEWFGCNKETTRCFGTVVGDTPAYLYEERWTPPCCLRALRETARYVVGVLEAAGVRYWLEGGSLLGAARHGDIIPWDYDVDLGIYLEDVGNCEQLRGAEAGSVVDERGFVWEKAVEGDFFRVQYSESNHLHVDLWPFYPRNGVMTKDTWLDHRQDVEFPEHFLQPLVPLPFAGFVAQAPNNYRRFLELKFGPGVIENPQYPNPALLSLTGSG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0222-Ab Anti-FKRP/ LGMD2I/ LGMDR9 functional antibody
    Target Antigen GM-Tg-g-SE0222-Ag FKRP protein
    ORF Viral Vector pGMLP001501 Human FKRP Lentivirus plasmid
    ORF Viral Vector vGMLP001501 Human FKRP Lentivirus particle


    Target information

    Target ID GM-SE0222
    Target Name FKRP
    Gene ID 79147, 243853, 716804, 308390, 101099604, 484426, 539701, 102148152
    Gene Symbol and Synonyms A830029B19Rik,FKRP,FKTR,LGMD1I,LGMD2I,LGMDR9,MDC1C,MDDGA5,MDDGB5,MDDGC5
    Uniprot Accession Q9H9S5
    Uniprot Entry Name FKRP_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000181027
    Target Classification Not Available

    This gene encodes a protein which is targeted to the medial Golgi apparatus and is necessary for posttranslational modification of dystroglycan. Mutations in this gene have been associated with congenital muscular dystrophy, cognitive disability, and cerebellar cysts. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Oct 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.