Human FKRP/LGMD2I/MDC1C ORF/cDNA clone-Lentivirus particle (NM_024301)
Cat. No.: vGMLP001501
Pre-made Human FKRP/LGMD2I/MDC1C Lentiviral expression plasmid for FKRP lentivirus packaging, FKRP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
FKRP/LGMD2I products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP001501 | Human FKRP Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP001501 |
| Gene Name | FKRP |
| Accession Number | NM_024301 |
| Gene ID | 79147 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 1488 bp |
| Gene Alias | LGMD2I,MDC1C,MDDGA5,MDDGB5,MDDGC5 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGCGGCTCACCCGCTGCCAGGCTGCCCTGGCGGCCGCCATCACCCTCAACCTTCTGGTCCTCTTCTATGTCTCGTGGCTGCAGCACCAGCCTAGGAATTCCCGGGCCCGGGGGCCCCGTCGTGCCTCTGCTGCCGGCCCCCGTGTCACCGTCCTGGTGCGGGAGTTCGAGGCATTTGACAACGCGGTGCCCGAGCTGGTAGACTCCTTCCTGCAGCAAGACCCAGCCCAGCCCGTGGTGGTGGCAGCCGACACGCTCCCCTACCCGCCCCTGGCCCTGCCCCGCATCCCCAACGTGCGTCTGGCGCTGCTCCAGCCCGCCCTGGACCGGCCAGCCGCAGCCTCGCGCCCGGAGACCTACGTGGCCACCGAGTTTGTGGCCCTAGTACCTGATGGGGCGCGGGCTGAGGCACCTGGCCTGCTGGAGCGCATGGTGGAGGCGCTCCGCGCAGGAAGCGCACGTCTGGTGGCCGCCCCGGTTGCCACGGCCAACCCTGCCAGGTGCCTGGCCCTGAACGTCAGCCTGCGAGAGTGGACCGCCCGCTATGGCGCAGCCCCCGCCGCGCCCCGCTGCGACGCCCTGGACGGAGATGCTGTGGTGCTCCTGCGCGCCCGCGACCTCTTCAACCTCTCGGCGCCCCTGGCCCGGCCGGTGGGCACCAGCCTCTTTCTGCAGACCGCCCTTCGCGGCTGGGCGGTGCAGCTGCTGGACTTGACCTTCGCCGCGGCGCGCCAGCCCCCGCTGGCCACGGCCCACGCGCGCTGGAAGGCTGAGCGCGAGGGACGCGCTCGGCGGGCGGCGCTGCTCCGCGCGCTGGGCATCCGCCTAGTGAGCTGGGAAGGCGGGCGGCTGGAGTGGTTCGGCTGCAACAAGGAGACCACGCGCTGCTTCGGAACCGTGGTGGGCGACACGCCCGCCTACCTCTACGAGGAGCGCTGGACGCCCCCCTGCTGCCTGCGCGCGCTGCGCGAGACCGCCCGCTATGTGGTGGGCGTGCTGGAGGCTGCGGGCGTGCGCTACTGGCTCGAGGGCGGCTCACTGCTGGGGGCCGCCCGCCACGGGGACATCATCCCATGGGACTACGACGTGGACCTGGGCATCTACTTGGAGGACGTGGGCAACTGCGAGCAGCTGCGGGGGGCAGAGGCCGGCTCGGTGGTGGATGAGCGCGGCTTCGTATGGGAGAAGGCGGTCGAGGGCGACTTTTTCCGCGTGCAGTACAGCGAAAGCAACCACTTGCACGTGGACCTGTGGCCCTTCTACCCCCGCAATGGCGTCATGACCAAGGACACGTGGCTGGACCACCGGCAGGATGTGGAGTTTCCCGAGCACTTCCTGCAGCCGCTGGTGCCCCTGCCCTTTGCCGGCTTCGTGGCGCAGGCGCCTAACAACTACCGCCGCTTCCTGGAGCTCAAGTTCGGGCCCGGGGTCATCGAGAACCCCCAGTACCCCAACCCGGCACTGCTGAGTCTGACGGGAAGCGGCTGA |
| ORF Protein Sequence | MRLTRCQAALAAAITLNLLVLFYVSWLQHQPRNSRARGPRRASAAGPRVTVLVREFEAFDNAVPELVDSFLQQDPAQPVVVAADTLPYPPLALPRIPNVRLALLQPALDRPAAASRPETYVATEFVALVPDGARAEAPGLLERMVEALRAGSARLVAAPVATANPARCLALNVSLREWTARYGAAPAAPRCDALDGDAVVLLRARDLFNLSAPLARPVGTSLFLQTALRGWAVQLLDLTFAAARQPPLATAHARWKAEREGRARRAALLRALGIRLVSWEGGRLEWFGCNKETTRCFGTVVGDTPAYLYEERWTPPCCLRALRETARYVVGVLEAAGVRYWLEGGSLLGAARHGDIIPWDYDVDLGIYLEDVGNCEQLRGAEAGSVVDERGFVWEKAVEGDFFRVQYSESNHLHVDLWPFYPRNGVMTKDTWLDHRQDVEFPEHFLQPLVPLPFAGFVAQAPNNYRRFLELKFGPGVIENPQYPNPALLSLTGSG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-SE0222-Ab | Anti-FKRP/ LGMD2I/ LGMDR9 functional antibody |
| Target Antigen | GM-Tg-g-SE0222-Ag | FKRP protein |
| ORF Viral Vector | pGMLP001501 | Human FKRP Lentivirus plasmid |
| ORF Viral Vector | vGMLP001501 | Human FKRP Lentivirus particle |
Target information
| Target ID | GM-SE0222 |
| Target Name | FKRP |
| Gene ID | 79147, 243853, 716804, 308390, 101099604, 484426, 539701, 102148152 |
| Gene Symbol and Synonyms | A830029B19Rik,FKRP,FKTR,LGMD1I,LGMD2I,LGMDR9,MDC1C,MDDGA5,MDDGB5,MDDGC5 |
| Uniprot Accession | Q9H9S5 |
| Uniprot Entry Name | FKRP_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000181027 |
| Target Classification | Not Available |
This gene encodes a protein which is targeted to the medial Golgi apparatus and is necessary for posttranslational modification of dystroglycan. Mutations in this gene have been associated with congenital muscular dystrophy, cognitive disability, and cerebellar cysts. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Oct 2008]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


