Human S1PR2/AGR16/DFNB68 ORF/cDNA clone-Lentivirus plasmid (NM_004230)

Cat. No.: pGMLP001564
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human S1PR2/AGR16/DFNB68 Lentiviral expression plasmid for S1PR2 lentivirus packaging, S1PR2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to S1PR2/AGR16 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $597.36
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001564
Gene Name S1PR2
Accession Number NM_004230
Gene ID 9294
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1062 bp
Gene Alias AGR16,DFNB68,EDG-5,EDG5,Gpcr13,H218,LPB2,S1P2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGCAGCTTGTACTCGGAGTACCTGAACCCCAACAAGGTCCAGGAACACTATAATTATACCAAGGAGACGCTGGAAACGCAGGAGACGACCTCCCGCCAGGTGGCCTCGGCCTTCATCGTCATCCTCTGTTGCGCCATTGTGGTGGAAAACCTTCTGGTGCTCATTGCGGTGGCCCGAAACAGCAAGTTCCACTCGGCAATGTACCTGTTTCTGGGCAACCTGGCCGCCTCCGATCTACTGGCAGGCGTGGCCTTCGTAGCCAATACCTTGCTCTCTGGCTCTGTCACGCTGAGGCTGACGCCTGTGCAGTGGTTTGCCCGGGAGGGCTCTGCCTTCATCACGCTCTCGGCCTCTGTCTTCAGCCTCCTGGCCATCGCCATTGAGCGCCACGTGGCCATTGCCAAGGTCAAGCTGTATGGCAGCGACAAGAGCTGCCGCATGCTTCTGCTCATCGGGGCCTCGTGGCTCATCTCGCTGGTCCTCGGTGGCCTGCCCATCCTTGGCTGGAACTGCCTGGGCCACCTCGAGGCCTGCTCCACTGTCCTGCCTCTCTACGCCAAGCATTATGTGCTGTGCGTGGTGACCATCTTCTCCATCATCCTGTTGGCCATCGTGGCCCTGTACGTGCGCATCTACTGCGTGGTCCGCTCAAGCCACGCTGACATGGCCGCCCCGCAGACGCTAGCCCTGCTCAAGACGGTCACCATCGTGCTAGGCGTCTTTATCGTCTGCTGGCTGCCCGCCTTCAGCATCCTCCTTCTGGACTATGCCTGTCCCGTCCACTCCTGCCCGATCCTCTACAAAGCCCACTACTTTTTCGCCGTCTCCACCCTGAATTCCCTGCTCAACCCCGTCATCTACACGTGGCGCAGCCGGGACCTGCGGCGGGAGGTGCTTCGGCCGCTGCAGTGCTGGAGGCCGGGGGTGGGGGTGCAAGGACGGAGGCGGGGCGGGACCCCGGGCCACCACCTCCTGCCACTCCGCAGCTCCAGCTCCCTGGAGAGGGGCATGCACATGCCCACGTCACCCACGTTTCTGGAGGGCAACACGGTGGTCTGA
ORF Protein Sequence MGSLYSEYLNPNKVQEHYNYTKETLETQETTSRQVASAFIVILCCAIVVENLLVLIAVARNSKFHSAMYLFLGNLAASDLLAGVAFVANTLLSGSVTLRLTPVQWFAREGSAFITLSASVFSLLAIAIERHVAIAKVKLYGSDKSCRMLLLIGASWLISLVLGGLPILGWNCLGHLEACSTVLPLYAKHYVLCVVTIFSIILLAIVALYVRIYCVVRSSHADMAAPQTLALLKTVTIVLGVFIVCWLPAFSILLLDYACPVHSCPILYKAHYFFAVSTLNSLLNPVIYTWRSRDLRREVLRPLQCWRPGVGVQGRRRGGTPGHHLLPLRSSSSLERGMHMPTSPTFLEGNTVV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T47888-Ab Anti-S1PR2/ AGR16/ DFNB68 monoclonal antibody
    Target Antigen GM-Tg-g-T47888-Ag S1PR2 VLP (virus-like particle)
    ORF Viral Vector pGMLP001564 Human S1PR2 Lentivirus plasmid
    ORF Viral Vector pGMAD000994 Human S1PR2 Adenovirus plasmid
    ORF Viral Vector vGMLP001564 Human S1PR2 Lentivirus particle
    ORF Viral Vector vGMAD000994 Human S1PR2 Adenovirus particle


    Target information

    Target ID GM-T47888
    Target Name S1PR2
    Gene ID 9294, 14739, 712143, 29415, 101088909, 484959, 540305, 100058299
    Gene Symbol and Synonyms 1100001A16Rik,AGR16,DFNB68,EDG-5,EDG5,Gpcr13,GPCR18,H218,LPB2,S1P2,S1PR2,snGPCR18
    Uniprot Accession O95136
    Uniprot Entry Name S1PR2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000267534
    Target Classification GPCR

    This gene encodes a member of the G protein-coupled receptors, as well as the EDG family of proteins. The encoded protein is a receptor for sphingosine 1-phosphate, which participates in cell proliferation, survival, and transcriptional activation. Defects in this gene have been associated with congenital profound deafness. [provided by RefSeq, Mar 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.