Human S1PR2/AGR16/DFNB68 ORF/cDNA clone-Lentivirus particle (NM_004230)
Cat. No.: vGMLP001564
Pre-made Human S1PR2/AGR16/DFNB68 Lentiviral expression plasmid for S1PR2 lentivirus packaging, S1PR2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
S1PR2/AGR16 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP001564 | Human S1PR2 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP001564 |
| Gene Name | S1PR2 |
| Accession Number | NM_004230 |
| Gene ID | 9294 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 1062 bp |
| Gene Alias | AGR16,DFNB68,EDG-5,EDG5,Gpcr13,H218,LPB2,S1P2 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGGCAGCTTGTACTCGGAGTACCTGAACCCCAACAAGGTCCAGGAACACTATAATTATACCAAGGAGACGCTGGAAACGCAGGAGACGACCTCCCGCCAGGTGGCCTCGGCCTTCATCGTCATCCTCTGTTGCGCCATTGTGGTGGAAAACCTTCTGGTGCTCATTGCGGTGGCCCGAAACAGCAAGTTCCACTCGGCAATGTACCTGTTTCTGGGCAACCTGGCCGCCTCCGATCTACTGGCAGGCGTGGCCTTCGTAGCCAATACCTTGCTCTCTGGCTCTGTCACGCTGAGGCTGACGCCTGTGCAGTGGTTTGCCCGGGAGGGCTCTGCCTTCATCACGCTCTCGGCCTCTGTCTTCAGCCTCCTGGCCATCGCCATTGAGCGCCACGTGGCCATTGCCAAGGTCAAGCTGTATGGCAGCGACAAGAGCTGCCGCATGCTTCTGCTCATCGGGGCCTCGTGGCTCATCTCGCTGGTCCTCGGTGGCCTGCCCATCCTTGGCTGGAACTGCCTGGGCCACCTCGAGGCCTGCTCCACTGTCCTGCCTCTCTACGCCAAGCATTATGTGCTGTGCGTGGTGACCATCTTCTCCATCATCCTGTTGGCCATCGTGGCCCTGTACGTGCGCATCTACTGCGTGGTCCGCTCAAGCCACGCTGACATGGCCGCCCCGCAGACGCTAGCCCTGCTCAAGACGGTCACCATCGTGCTAGGCGTCTTTATCGTCTGCTGGCTGCCCGCCTTCAGCATCCTCCTTCTGGACTATGCCTGTCCCGTCCACTCCTGCCCGATCCTCTACAAAGCCCACTACTTTTTCGCCGTCTCCACCCTGAATTCCCTGCTCAACCCCGTCATCTACACGTGGCGCAGCCGGGACCTGCGGCGGGAGGTGCTTCGGCCGCTGCAGTGCTGGAGGCCGGGGGTGGGGGTGCAAGGACGGAGGCGGGGCGGGACCCCGGGCCACCACCTCCTGCCACTCCGCAGCTCCAGCTCCCTGGAGAGGGGCATGCACATGCCCACGTCACCCACGTTTCTGGAGGGCAACACGGTGGTCTGA |
| ORF Protein Sequence | MGSLYSEYLNPNKVQEHYNYTKETLETQETTSRQVASAFIVILCCAIVVENLLVLIAVARNSKFHSAMYLFLGNLAASDLLAGVAFVANTLLSGSVTLRLTPVQWFAREGSAFITLSASVFSLLAIAIERHVAIAKVKLYGSDKSCRMLLLIGASWLISLVLGGLPILGWNCLGHLEACSTVLPLYAKHYVLCVVTIFSIILLAIVALYVRIYCVVRSSHADMAAPQTLALLKTVTIVLGVFIVCWLPAFSILLLDYACPVHSCPILYKAHYFFAVSTLNSLLNPVIYTWRSRDLRREVLRPLQCWRPGVGVQGRRRGGTPGHHLLPLRSSSSLERGMHMPTSPTFLEGNTVV |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T47888-Ab | Anti-S1PR2/ AGR16/ DFNB68 monoclonal antibody |
| Target Antigen | GM-Tg-g-T47888-Ag | S1PR2 VLP (virus-like particle) |
| ORF Viral Vector | pGMLP001564 | Human S1PR2 Lentivirus plasmid |
| ORF Viral Vector | pGMAD000994 | Human S1PR2 Adenovirus plasmid |
| ORF Viral Vector | vGMLP001564 | Human S1PR2 Lentivirus particle |
| ORF Viral Vector | vGMAD000994 | Human S1PR2 Adenovirus particle |
Target information
| Target ID | GM-T47888 |
| Target Name | S1PR2 |
| Gene ID | 9294, 14739, 712143, 29415, 101088909, 484959, 540305, 100058299 |
| Gene Symbol and Synonyms | 1100001A16Rik,AGR16,DFNB68,EDG-5,EDG5,Gpcr13,GPCR18,H218,LPB2,S1P2,S1PR2,snGPCR18 |
| Uniprot Accession | O95136 |
| Uniprot Entry Name | S1PR2_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target |
| Disease | Not Available |
| Gene Ensembl | ENSG00000267534 |
| Target Classification | GPCR |
This gene encodes a member of the G protein-coupled receptors, as well as the EDG family of proteins. The encoded protein is a receptor for sphingosine 1-phosphate, which participates in cell proliferation, survival, and transcriptional activation. Defects in this gene have been associated with congenital profound deafness. [provided by RefSeq, Mar 2016]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


