Human CAVIN1/CAVIN/cavin-1 ORF/cDNA clone-Lentivirus plasmid (NM_012232)

Cat. No.: pGMLP001720
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CAVIN1/CAVIN/cavin-1 Lentiviral expression plasmid for CAVIN1 lentivirus packaging, CAVIN1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to CAVIN1/CAVIN products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $628.44
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001720
Gene Name CAVIN1
Accession Number NM_012232
Gene ID 284119
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1173 bp
Gene Alias CAVIN,cavin-1,CGL4,FKSG13,PTRF
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGGACCCCACGCTCTATATTGTCGAGCGGCCGCTTCCCGGGTACCCCGACGCCGAGGCCCCGGAGCCTTCCTCCGCTGGGGCTCAGGCAGCGGAGGAGCCGTCGGGGGCCGGCTCAGAAGAGCTGATCAAGTCGGACCAGGTGAACGGCGTGCTGGTGCTGAGCCTCCTGGACAAAATCATCGGGGCCGTAGACCAGATCCAGCTGACTCAAGCACAGCTGGAGGAGCGGCAGGCGGAGATGGAGGGCGCAGTGCAGAGCATCCAGGGCGAGCTGAGCAAGCTGGGCAAGGCGCACGCCACCACGAGCAATACGGTGAGCAAGCTGCTGGAGAAGGTGCGCAAGGTCAGCGTCAACGTGAAGACCGTGCGCGGCAGCCTGGAGCGCCAGGCGGGGCAGATCAAGAAGCTGGAGGTCAACGAGGCCGAGCTGCTGCGGCGCCGCAACTTTAAAGTCATGATCTACCAGGATGAAGTGAAGCTGCCGGCCAAACTGAGCATCAGCAAATCGCTGAAAGAGTCGGAGGCGCTGCCAGAGAAGGAGGGCGAGGAGCTGGGCGAGGGCGAGCGGCCCGAGGAGGACGCAGCGGCGCTGGAGCTTTCGTCGGACGAGGCGGTGGAGGTTGAGGAGGTTATTGAGGAGTCCCGCGCAGAGCGTATCAAGCGCAGCGGCCTGCGGCGCGTGGACGACTTCAAGAAGGCCTTCTCCAAGGAGAAGATGGAGAAGACCAAGGTGCGTACCCGCGAGAACCTGGAGAAGACGCGCCTCAAGACCAAGGAAAACCTGGAGAAGACGCGGCACACCCTGGAGAAGCGCATGAACAAGCTGGGCACGCGCCTGGTGCCCGCCGAGCGGCGCGAGAAACTGAAGACGTCGCGGGACAAGTTGCGCAAATCCTTCACGCCCGACCACGTGGTGTACGCGCGCTCCAAGACCGCGGTCTACAAGGTGCCACCCTTCACCTTCCACGTCAAGAAGATCCGCGAGGGCCAGGTGGAAGTGCTCAAGGCCACCGAGATGGTGGAGGTGGGCGCCGACGACGACGAGGGCGGCGCGGAGCGCGGGGAGGCCGGCGACCTGCGGCGCGGGAGCAGCCCCGACGTGCACGCGCTGCTGGAGATCACCGAGGAGTCGGACGCCGTGCTGGTGGACAAGAGCGACAGCGACTGA
ORF Protein Sequence MEDPTLYIVERPLPGYPDAEAPEPSSAGAQAAEEPSGAGSEELIKSDQVNGVLVLSLLDKIIGAVDQIQLTQAQLEERQAEMEGAVQSIQGELSKLGKAHATTSNTVSKLLEKVRKVSVNVKTVRGSLERQAGQIKKLEVNEAELLRRRNFKVMIYQDEVKLPAKLSISKSLKESEALPEKEGEELGEGERPEEDAAALELSSDEAVEVEEVIEESRAERIKRSGLRRVDDFKKAFSKEKMEKTKVRTRENLEKTRLKTKENLEKTRHTLEKRMNKLGTRLVPAERREKLKTSRDKLRKSFTPDHVVYARSKTAVYKVPPFTFHVKKIREGQVEVLKATEMVEVGADDDEGGAERGEAGDLRRGSSPDVHALLEITEESDAVLVDKSDSD

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2033-Ab Anti-CAVN1/ CAVIN1/ CAVIN monoclonal antibody
    Target Antigen GM-Tg-g-MP2033-Ag CAVIN1 VLP (virus-like particle)
    ORF Viral Vector pGMLP001720 Human CAVIN1 Lentivirus plasmid
    ORF Viral Vector pGMPC000563 Human CAVIN1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP001720 Human CAVIN1 Lentivirus particle


    Target information

    Target ID GM-MP2033
    Target Name CAVIN1
    Gene ID 284119, 19285, 706570, 287710, 101096121, 100855435, 538457, 100066120
    Gene Symbol and Synonyms 2310075E07Rik,Cav-p60,CAVIN,cavin-1,CAVIN1,CGL4,FKSG13,PTRF
    Uniprot Accession Q6NZI2
    Uniprot Entry Name CAVN1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Prostate Cancer
    Gene Ensembl ENSG00000177469
    Target Classification Not Available

    This gene encodes a protein that enables the dissociation of paused ternary polymerase I transcription complexes from the 3' end of pre-rRNA transcripts. This protein regulates rRNA transcription by promoting the dissociation of transcription complexes and the reinitiation of polymerase I on nascent rRNA transcripts. This protein also localizes to caveolae at the plasma membrane and is thought to play a critical role in the formation of caveolae and the stabilization of caveolins. This protein translocates from caveolae to the cytoplasm after insulin stimulation. Caveolae contain truncated forms of this protein and may be the site of phosphorylation-dependent proteolysis. This protein is also thought to modify lipid metabolism and insulin-regulated gene expression. Mutations in this gene result in a disorder characterized by generalized lipodystrophy and muscular dystrophy. [provided by RefSeq, Nov 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.