Human EFNB3/EFL6/EPLG8 ORF/cDNA clone-Lentivirus plasmid (NM_001406)

Cat. No.: pGMLP001769
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human EFNB3/EFL6/EPLG8 Lentiviral expression plasmid for EFNB3 lentivirus packaging, EFNB3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to EFNB3/EFL6 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $586.44
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001769
Gene Name EFNB3
Accession Number NM_001406
Gene ID 1949
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1023 bp
Gene Alias EFL6,EPLG8,LERK8
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGGCCCCCCCATTCTGGGCCGGGGGGCGTGCGAGTCGGGGCCCTGCTGCTGCTGGGGGTTTTGGGGCTGGTGTCTGGGCTCAGCCTGGAGCCTGTCTACTGGAACTCGGCGAATAAGAGGTTCCAGGCAGAGGGTGGTTATGTGCTGTACCCTCAGATCGGGGACCGGCTAGACCTGCTCTGCCCCCGGGCCCGGCCTCCTGGCCCTCACTCCTCTCCTAATTATGAGTTCTACAAGCTGTACCTGGTAGGGGGTGCTCAGGGCCGGCGCTGTGAGGCACCCCCTGCCCCAAACCTCCTTCTCACTTGTGATCGCCCAGACCTGGATCTCCGCTTCACCATCAAGTTCCAGGAGTATAGCCCTAATCTCTGGGGCCACGAGTTCCGCTCGCACCACGATTACTACATCATTGCCACATCGGATGGGACCCGGGAGGGCCTGGAGAGCCTGCAGGGAGGTGTGTGCCTAACCAGAGGCATGAAGGTGCTTCTCCGAGTGGGACAAAGTCCCCGAGGAGGGGCTGTCCCCCGAAAACCTGTGTCTGAAATGCCCATGGAAAGAGACCGAGGGGCAGCCCACAGCCTGGAGCCTGGGAAGGAGAACCTGCCAGGTGACCCCACCAGCAATGCAACCTCCCGGGGTGCTGAAGGCCCCCTGCCCCCTCCCAGCATGCCTGCAGTGGCTGGGGCAGCAGGGGGGCTGGCGCTGCTCTTGCTGGGCGTGGCAGGGGCTGGGGGTGCCATGTGTTGGCGGAGACGGCGGGCCAAGCCTTCGGAGAGTCGCCACCCTGGTCCTGGCTCCTTCGGGAGGGGAGGGTCTCTGGGCCTGGGGGGTGGAGGTGGGATGGGACCTCGGGAGGCTGAGCCTGGGGAGCTAGGGATAGCTCTGCGGGGTGGCGGGGCTGCAGATCCCCCCTTCTGCCCCCACTATGAGAAGGTGAGTGGTGACTATGGGCATCCTGTGTATATCGTGCAGGATGGGCCCCCCCAGAGCCCTCCAAACATCTACTACAAGGTATGA
ORF Protein Sequence MGPPHSGPGGVRVGALLLLGVLGLVSGLSLEPVYWNSANKRFQAEGGYVLYPQIGDRLDLLCPRARPPGPHSSPNYEFYKLYLVGGAQGRRCEAPPAPNLLLTCDRPDLDLRFTIKFQEYSPNLWGHEFRSHHDYYIIATSDGTREGLESLQGGVCLTRGMKVLLRVGQSPRGGAVPRKPVSEMPMERDRGAAHSLEPGKENLPGDPTSNATSRGAEGPLPPPSMPAVAGAAGGLALLLLGVAGAGGAMCWRRRRAKPSESRHPGPGSFGRGGSLGLGGGGGMGPREAEPGELGIALRGGGAADPPFCPHYEKVSGDYGHPVYIVQDGPPQSPPNIYYKV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0399-Ab Anti-EFNB3/ EFL6/ EPLG8 monoclonal antibody
    Target Antigen GM-Tg-g-MP0399-Ag EFNB3 VLP (virus-like particle)
    ORF Viral Vector pGMLP001769 Human EFNB3 Lentivirus plasmid
    ORF Viral Vector vGMLP001769 Human EFNB3 Lentivirus particle


    Target information

    Target ID GM-MP0399
    Target Name EFNB3
    Gene ID 1949, 13643, 716257, 360546, 100135768, 607903, 617714, 100062080
    Gene Symbol and Synonyms EFL-6,EFL6,EFNB3,ELF-3,Elk-L3,Epl8,EPLG8,LERK-8,LERK8,NLERK-2
    Uniprot Accession Q15768
    Uniprot Entry Name EFNB3_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000108947
    Target Classification Not Available

    EFNB3, a member of the ephrin gene family, is important in brain development as well as in its maintenance. Moreover, since levels of EFNB3 expression were particularly high in several forebrain subregions compared to other brain subregions, it may play a pivotal role in forebrain function.  The EPH and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, particularly in the nervous system. EPH Receptors typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin ligands and receptors have been named by the Eph Nomenclature Committee (1997). Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are similarly divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.