Human EFNB3/EFL6/EPLG8 ORF/cDNA clone-Lentivirus particle (NM_001406)
Cat. No.: vGMLP001769
Pre-made Human EFNB3/EFL6/EPLG8 Lentiviral expression plasmid for EFNB3 lentivirus packaging, EFNB3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
EFNB3/EFL6 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP001769 | Human EFNB3 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP001769 |
| Gene Name | EFNB3 |
| Accession Number | NM_001406 |
| Gene ID | 1949 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 1023 bp |
| Gene Alias | EFL6,EPLG8,LERK8 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGGGCCCCCCCATTCTGGGCCGGGGGGCGTGCGAGTCGGGGCCCTGCTGCTGCTGGGGGTTTTGGGGCTGGTGTCTGGGCTCAGCCTGGAGCCTGTCTACTGGAACTCGGCGAATAAGAGGTTCCAGGCAGAGGGTGGTTATGTGCTGTACCCTCAGATCGGGGACCGGCTAGACCTGCTCTGCCCCCGGGCCCGGCCTCCTGGCCCTCACTCCTCTCCTAATTATGAGTTCTACAAGCTGTACCTGGTAGGGGGTGCTCAGGGCCGGCGCTGTGAGGCACCCCCTGCCCCAAACCTCCTTCTCACTTGTGATCGCCCAGACCTGGATCTCCGCTTCACCATCAAGTTCCAGGAGTATAGCCCTAATCTCTGGGGCCACGAGTTCCGCTCGCACCACGATTACTACATCATTGCCACATCGGATGGGACCCGGGAGGGCCTGGAGAGCCTGCAGGGAGGTGTGTGCCTAACCAGAGGCATGAAGGTGCTTCTCCGAGTGGGACAAAGTCCCCGAGGAGGGGCTGTCCCCCGAAAACCTGTGTCTGAAATGCCCATGGAAAGAGACCGAGGGGCAGCCCACAGCCTGGAGCCTGGGAAGGAGAACCTGCCAGGTGACCCCACCAGCAATGCAACCTCCCGGGGTGCTGAAGGCCCCCTGCCCCCTCCCAGCATGCCTGCAGTGGCTGGGGCAGCAGGGGGGCTGGCGCTGCTCTTGCTGGGCGTGGCAGGGGCTGGGGGTGCCATGTGTTGGCGGAGACGGCGGGCCAAGCCTTCGGAGAGTCGCCACCCTGGTCCTGGCTCCTTCGGGAGGGGAGGGTCTCTGGGCCTGGGGGGTGGAGGTGGGATGGGACCTCGGGAGGCTGAGCCTGGGGAGCTAGGGATAGCTCTGCGGGGTGGCGGGGCTGCAGATCCCCCCTTCTGCCCCCACTATGAGAAGGTGAGTGGTGACTATGGGCATCCTGTGTATATCGTGCAGGATGGGCCCCCCCAGAGCCCTCCAAACATCTACTACAAGGTATGA |
| ORF Protein Sequence | MGPPHSGPGGVRVGALLLLGVLGLVSGLSLEPVYWNSANKRFQAEGGYVLYPQIGDRLDLLCPRARPPGPHSSPNYEFYKLYLVGGAQGRRCEAPPAPNLLLTCDRPDLDLRFTIKFQEYSPNLWGHEFRSHHDYYIIATSDGTREGLESLQGGVCLTRGMKVLLRVGQSPRGGAVPRKPVSEMPMERDRGAAHSLEPGKENLPGDPTSNATSRGAEGPLPPPSMPAVAGAAGGLALLLLGVAGAGGAMCWRRRRAKPSESRHPGPGSFGRGGSLGLGGGGGMGPREAEPGELGIALRGGGAADPPFCPHYEKVSGDYGHPVYIVQDGPPQSPPNIYYKV |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-MP0399-Ab | Anti-EFNB3/ EFL6/ EPLG8 monoclonal antibody |
| Target Antigen | GM-Tg-g-MP0399-Ag | EFNB3 VLP (virus-like particle) |
| ORF Viral Vector | pGMLP001769 | Human EFNB3 Lentivirus plasmid |
| ORF Viral Vector | vGMLP001769 | Human EFNB3 Lentivirus particle |
Target information
| Target ID | GM-MP0399 |
| Target Name | EFNB3 |
| Gene ID | 1949, 13643, 716257, 360546, 100135768, 607903, 617714, 100062080 |
| Gene Symbol and Synonyms | EFL-6,EFL6,EFNB3,ELF-3,Elk-L3,Epl8,EPLG8,LERK-8,LERK8,NLERK-2 |
| Uniprot Accession | Q15768 |
| Uniprot Entry Name | EFNB3_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000108947 |
| Target Classification | Not Available |
EFNB3, a member of the ephrin gene family, is important in brain development as well as in its maintenance. Moreover, since levels of EFNB3 expression were particularly high in several forebrain subregions compared to other brain subregions, it may play a pivotal role in forebrain function. The EPH and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, particularly in the nervous system. EPH Receptors typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin ligands and receptors have been named by the Eph Nomenclature Committee (1997). Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are similarly divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. [provided by RefSeq, Jul 2008]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


