Human MYLK/AAT7/KRP ORF/cDNA clone-Lentivirus plasmid (NM_053031)
Cat. No.: pGMLP001820
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human MYLK/AAT7/KRP Lentiviral expression plasmid for MYLK lentivirus packaging, MYLK lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
MYLK/AAT7 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP001820 |
Gene Name | MYLK |
Accession Number | NM_053031 |
Gene ID | 4638 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 462 bp |
Gene Alias | AAT7,KRP,MLCK,MLCK1,MLCK108,MLCK210,MSTP083,MYLK1,smMLCK |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCAATGATCTCAGGGCTCAGTGGCAGGAAATCCTCAACAGGGTCACCAACCAGCCCGCTCAATGCAGAAAAACTAGAATCTGAAGATGTGTCCCAAGCTTTCCTTGAGGCTGTTGCTGAGGAAAAGCCTCATGTAAAACCCTATTTCTCTAAGACCATTCGCGATTTAGAAGTTGTGGAGGGAAGTGCTGCTAGATTTGACTGCAAGATTGAAGGATACCCAGACCCCGAGGTTGTCTGGTTCAAAGATGACCAGTCAATCAGGGAGTCCCGCCACTTCCAGATAGACTACGATGAGGACGGGAACTGCTCTTTAATTATTAGTGATGTTTGCGGGGATGACGATGCCAAGTACACCTGCAAGGCTGTCAACAGTCTTGGAGAAGCCACCTGCACAGCAGAGCTCATTGTGGAAACGATGGAGGAAGGTGAAGGGGAAGGGGAAGAGGAAGAAGAGTGA |
ORF Protein Sequence | MAMISGLSGRKSSTGSPTSPLNAEKLESEDVSQAFLEAVAEEKPHVKPYFSKTIRDLEVVEGSAARFDCKIEGYPDPEVVWFKDDQSIRESRHFQIDYDEDGNCSLIISDVCGDDDAKYTCKAVNSLGEATCTAELIVETMEEGEGEGEEEEE |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T97141-Ab | Anti-MYLK/ AAT7/ KRP monoclonal antibody |
Target Antigen | GM-Tg-g-T97141-Ag | MYLK VLP (virus-like particle) |
ORF Viral Vector | pGMLP000989 | Human MYLK Lentivirus plasmid |
ORF Viral Vector | pGMLP001820 | Human MYLK Lentivirus plasmid |
ORF Viral Vector | pGMAD000885 | Human MYLK Adenovirus plasmid |
ORF Viral Vector | vGMLP000989 | Human MYLK Lentivirus particle |
ORF Viral Vector | vGMLP001820 | Human MYLK Lentivirus particle |
ORF Viral Vector | vGMAD000885 | Human MYLK Adenovirus particle |
Target information
Target ID | GM-T97141 |
Target Name | MYLK |
Gene ID | 4638, 107589, 715422, 288057, 494213, 488012, 338037, 100070482 |
Gene Symbol and Synonyms | 9530072E15Rik,A930019C19Rik,AAT7,KRP,MLCK,MLCK1,MLCK108,MLCK210,MMIHS,MMIHS1,MSTP083,MYLK,MYLK-L,MYLK1,nmMlck,smMLCK |
Uniprot Accession | Q15746 |
Uniprot Entry Name | MYLK_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000065534 |
Target Classification | Kinase |
This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.