Human MYLK/AAT7/KRP ORF/cDNA clone-Lentivirus particle (NM_053031)

Cat. No.: vGMLP000989

Pre-made Human MYLK/AAT7/KRP Lentiviral expression plasmid for MYLK lentivirus packaging, MYLK lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to MYLK/AAT7 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000989 Human MYLK Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000989
Gene Name MYLK
Accession Number NM_053031
Gene ID 4638
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 462 bp
Gene Alias AAT7,KRP,MLCK,MLCK1,MLCK108,MLCK210,MSTP083,MYLK1,smMLCK
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCAATGATCTCAGGGCTCAGTGGCAGGAAATCCTCAACAGGGTCACCAACCAGCCCGCTCAATGCAGAAAAACTAGAATCTGAAGATGTGTCCCAAGCTTTCCTTGAGGCTGTTGCTGAGGAAAAGCCTCATGTAAAACCCTATTTCTCTAAGACCATTCGCGATTTAGAAGTTGTGGAGGGAAGTGCTGCTAGATTTGACTGCAAGATTGAAGGATACCCAGACCCCGAGGTTGTCTGGTTCAAAGATGACCAGTCAATCAGGGAGTCCCGCCACTTCCAGATAGACTACGATGAGGACGGGAACTGCTCTTTAATTATTAGTGATGTTTGCGGGGATGACGATGCCAAGTACACCTGCAAGGCTGTCAACAGTCTTGGAGAAGCCACCTGCACAGCAGAGCTCATTGTGGAAACGATGGAGGAAGGTGAAGGGGAAGGGGAAGAGGAAGAAGAGTGA
ORF Protein Sequence MAMISGLSGRKSSTGSPTSPLNAEKLESEDVSQAFLEAVAEEKPHVKPYFSKTIRDLEVVEGSAARFDCKIEGYPDPEVVWFKDDQSIRESRHFQIDYDEDGNCSLIISDVCGDDDAKYTCKAVNSLGEATCTAELIVETMEEGEGEGEEEEE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T97141-Ab Anti-MYLK/ AAT7/ KRP monoclonal antibody
    Target Antigen GM-Tg-g-T97141-Ag MYLK VLP (virus-like particle)
    ORF Viral Vector pGMLP000989 Human MYLK Lentivirus plasmid
    ORF Viral Vector pGMLP001820 Human MYLK Lentivirus plasmid
    ORF Viral Vector pGMAD000885 Human MYLK Adenovirus plasmid
    ORF Viral Vector vGMLP000989 Human MYLK Lentivirus particle
    ORF Viral Vector vGMLP001820 Human MYLK Lentivirus particle
    ORF Viral Vector vGMAD000885 Human MYLK Adenovirus particle


    Target information

    Target ID GM-T97141
    Target Name MYLK
    Gene ID 4638, 107589, 715422, 288057, 494213, 488012, 338037, 100070482
    Gene Symbol and Synonyms 9530072E15Rik,A930019C19Rik,AAT7,KRP,MLCK,MLCK1,MLCK108,MLCK210,MMIHS,MMIHS1,MSTP083,MYLK,MYLK-L,MYLK1,nmMlck,smMLCK
    Uniprot Accession Q15746
    Uniprot Entry Name MYLK_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000065534
    Target Classification Kinase

    This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.