Human TNFSF4/CD134L/ CD252 ORF/cDNA clone-Lentivirus plasmid (NM_003326)

Pre-made Human TNFSF4/CD134L/ CD252 Lentiviral expression plasmid for TNFSF4 lentivirus packaging, TNFSF4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to OX40/TNFSF4/CD134L products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP001853 Human TNFSF4 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP001853
Gene Name TNFSF4
Accession Number NM_003326
Gene ID 7292
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 552 bp
Gene Alias CD134L, CD252, GP34, OX-40L, OX4OL, TNLG2B, TXGP1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAAAGGGTCCAACCCCTGGAAGAGAATGTGGGAAATGCAGCCAGGCCAAGATTCGAGAGGAACAAGCTATTGCTGGTGGCCTCTGTAATTCAGGGACTGGGGCTGCTCCTGTGCTTCACCTACATCTGCCTGCACTTCTCTGCTCTTCAGGTATCACATCGGTATCCTCGAATTCAAAGTATCAAAGTACAATTTACCGAATATAAGAAGGAGAAAGGTTTCATCCTCACTTCCCAAAAGGAGGATGAAATCATGAAGGTGCAGAACAACTCAGTCATCATCAACTGTGATGGGTTTTATCTCATCTCCCTGAAGGGCTACTTCTCCCAGGAAGTCAACATTAGCCTTCATTACCAGAAGGATGAGGAGCCCCTCTTCCAACTGAAGAAGGTCAGGTCTGTCAACTCCTTGATGGTGGCCTCTCTGACTTACAAAGACAAAGTCTACTTGAATGTGACCACTGACAATACCTCCCTGGATGACTTCCATGTGAATGGCGGAGAACTGATTCTTATCCATCAAAATCCTGGTGAATTCTGTGTCCTTTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-553 Pre-Made Tavolimab biosimilar, Whole mAb, Anti-TNFSF4/OX40 Antibody: Anti-CD134L/CD252/GP34/OX-40L/OX4OL/TNLG2B/TXGP1 therapeutic antibody
    Biosimilar GMP-Bios-ab-417 Pre-Made Oxelumab biosimilar, Whole mAb, Anti-TNFSF4/OX40 Antibody: Anti-CD134L/CD252/GP34/OX-40L/OX4OL/TNLG2B/TXGP1 therapeutic antibody
    Biosimilar GMP-Bios-ab-554 Pre-Made Tavolixizumab biosimilar, Whole mAb, Anti-TNFSF4/OX40 Antibody: Anti-CD134L/CD252/GP34/OX-40L/OX4OL/TNLG2B/TXGP1 therapeutic antibody
    Biosimilar GMP-Bios-ab-022 Pre-Made Amlitelimab biosimilar, Whole mAb, Anti-TNFSF4/OX40 Antibody: Anti-CD134L/CD252/GP34/OX-40L/OX4OL/TNLG2B/TXGP1 therapeutic antibody
    Target Antibody GM-Tg-g-T55860-Ab Anti-TNFL4/ OX40/ TNFSF4 monoclonal antibody
    Target Antigen GM-Tg-g-T55860-Ag OX40/TNFSF4 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T55860 tumor necrosis factor (ligand) superfamily, member 4 (TNFSF4) protein & antibody
    ORF Viral Vector pGMLV001892 Human TNFSF4 Lentivirus plasmid
    ORF Viral Vector pGMLP001853 Human TNFSF4 Lentivirus plasmid
    ORF Viral Vector vGMLV001892 Human TNFSF4 Lentivirus particle
    ORF Viral Vector vGMLP001853 Human TNFSF4 Lentivirus particle


    Target information

    Target ID GM-T55860
    Target Name OX40
    Gene ID 7292, 22164, 706255, 89814, 790947, 100855878, 539800, 100060605
    Gene Symbol and Synonyms Ath-1,Ath1,CD134L,CD252,GP34,OX-40L,Ox40l,OX4OL,TNFSF4,TNLG2B,TXGP1,Txgp1l
    Uniprot Accession P23510
    Uniprot Entry Name TNFL4_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000117586
    Target Classification Checkpoint-Immuno Oncology

    This gene encodes a cytokine of the tumor necrosis factor (TNF) ligand family. The encoded protein functions in T cell antigen-presenting cell (APC) interactions and mediates adhesion of activated T cells to endothelial cells. Polymorphisms in this gene have been associated with Sjogren's syndrome and systemic lupus erythematosus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.