Human HAVCR1/CD365/HAVCR ORF/cDNA clone-Lentivirus plasmid (NM_001308156.1)
Cat. No.: pGMLP001952
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human HAVCR1/CD365/HAVCR Lentiviral expression plasmid for HAVCR1 lentivirus packaging, HAVCR1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
HAVCR1/CD365 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP001952 |
Gene Name | HAVCR1 |
Accession Number | NM_001308156.1 |
Gene ID | 26762 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1206 bp |
Gene Alias | CD365,HAVCR,HAVCR-1,KIM-1,KIM1,TIM,TIM-1,TIM1,TIMD-1,TIMD1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGCATCCTCAAGTGGTCATCTTAAGCCTCATCCTACATCTGGCAGATTCTGTAGCTGGTTCTGTAAAGGTTGGTGGAGAGGCAGGTCCATCTGTCACACTACCCTGCCACTACAGTGGAGCTGTCACATCCATGTGCTGGAATAGAGGCTCATGTTCTCTATTCACATGCCAAAATGGCATTGTCTGGACCAATGGAACCCACGTCACCTATCGGAAGGACACACGCTATAAGCTATTGGGGGACCTTTCAAGAAGGGATGTCTCTTTGACCATAGAAAATACAGCTGTGTCTGACAGTGGCGTATATTGTTGCCGTGTTGAGCACCGTGGGTGGTTCAATGACATGAAAATCACCGTATCATTGGAGATTGTGCCACCCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTCGAACGAGCACCACTGTTCCAACGACAACGACTGTTCCAATGACGACTGTTCCAACGACAACTGTTCCAACAACAATGAGCATTCCAACGACAACGACTGTTCTGACGACAATGACTGTTTCAACGACAACGAGCGTTCCAACGACAACGAGCATTCCAACAACAACAAGTGTTCCAGTGACAACAACTGTCTCTACCTTTGTTCCTCCAATGCCTTTGCCCAGGCAGAACCATGAACCAGTAGCCACTTCACCATCTTCACCTCAGCCAGCAGAAACCCACCCTACGACACTGCAGGGAGCAATAAGGAGAGAACCCACCAGCTCACCATTGTACTCTTACACAACAGATGGGAATGACACCGTGACAGAGTCTTCAGATGGCCTTTGGAATAACAATCAAACTCAACTGTTCCTAGAACATAGTCTACTGACGGCCAATACCACTAAAGGAATCTATGCTGGAGTCTGTATTTCTGTCTTGGTGCTTCTTGCTCTTTTGGGTGTCATCATTGCCAAAATGTTTCATTTAGCAGCCTTCAAATTAAAGCTTTGCAAAATGCAGTTGAAAAGGAAGTCCAAGCAGAAGACAATATCTACATTGAGAATAGTCTTTATGCCACGGACTAAGACCCAGTGGTGCTCTTTGAGAGTTTACGCCCATGAGTGCAGAAGACTGAACAGACATCAGCACATCAGACGTCTTTTAGACCCCAAGACAATTTTTCTGTTTCAGTTTCATCTGGCATTCCAACATGTCAGTGATACTGGGTAG |
ORF Protein Sequence | MHPQVVILSLILHLADSVAGSVKVGGEAGPSVTLPCHYSGAVTSMCWNRGSCSLFTCQNGIVWTNGTHVTYRKDTRYKLLGDLSRRDVSLTIENTAVSDSGVYCCRVEHRGWFNDMKITVSLEIVPPKVTTTPIVTTVPTVTTVRTSTTVPTTTTVPMTTVPTTTVPTTMSIPTTTTVLTTMTVSTTTSVPTTTSIPTTTSVPVTTTVSTFVPPMPLPRQNHEPVATSPSSPQPAETHPTTLQGAIRREPTSSPLYSYTTDGNDTVTESSDGLWNNNQTQLFLEHSLLTANTTKGIYAGVCISVLVLLALLGVIIAKMFHLAAFKLKLCKMQLKRKSKQKTISTLRIVFMPRTKTQWCSLRVYAHECRRLNRHQHIRRLLDPKTIFLFQFHLAFQHVSDTG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP0572-Ab | Anti-HAVR1/ HAVCR1/ CD365 monoclonal antibody |
Target Antigen | GM-Tg-g-MP0572-Ag | HAVCR1 VLP (virus-like particle) |
ORF Viral Vector | pGMLP001952 | Human HAVCR1 Lentivirus plasmid |
ORF Viral Vector | vGMLP001952 | Human HAVCR1 Lentivirus particle |
Target information
Target ID | GM-MP0572 |
Target Name | HAVCR1 |
Gene ID | 26762, 715333, 101099778, 612069 |
Gene Symbol and Synonyms | CD365,HAVCR,HAVCR-1,HAVCR1,KIM-1,KIM1,TIM,TIM-1,TIM1,TIMD-1,TIMD1 |
Uniprot Accession | Q96D42 |
Uniprot Entry Name | HAVR1_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Renal fibrosis, Sickle Cell Nephropathy, Type 1 diabetes mellitus with diabetic nephropathy, Type 2 diabetes mellitus, Vasculitis, Vesicoureteral reflux, Acute kidney failure, Autosomal Dominant Polycystic Kidney Disease, Complications of kidney transplant, Congenital hydronephrosis, Cystic fibrosis with pulmonary manifestations, Injury to Kidney, Intraoperative Renal Injury, Kidney disease, Neonatal urinary tract infection, Nephropathy induced by heavy metals, Proteinuria, Renal cell carcinoma, Hydronephrosis, Coronary artery disease, Nephrotic syndrome with diffuse membranous glomerulonephritis |
Gene Ensembl | ENSG00000113249 |
Target Classification | Not Available |
The protein encoded by this gene is a membrane receptor for both human hepatitis A virus (HHAV) and TIMD4. The encoded protein may be involved in the moderation of asthma and allergic diseases. The reference genome represents an allele that retains a MTTVP amino acid segment that confers protection against atopy in HHAV seropositive individuals. The protein is a receptor for multiple other viruses, including Ebola virus, Marburg virus, Dengue virus, and Zika virus and is a possible entry factor for SARS-CoV-2 and other coronaviruses. [provided by RefSeq, Sep 2021]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.