Human HAVCR1/CD365/HAVCR ORF/cDNA clone-Lentivirus plasmid (NM_001308156.1)

Cat. No.: pGMLP001952
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human HAVCR1/CD365/HAVCR Lentiviral expression plasmid for HAVCR1 lentivirus packaging, HAVCR1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to HAVCR1/CD365 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $637.68
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP001952
Gene Name HAVCR1
Accession Number NM_001308156.1
Gene ID 26762
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1206 bp
Gene Alias CD365,HAVCR,HAVCR-1,KIM-1,KIM1,TIM,TIM-1,TIM1,TIMD-1,TIMD1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCATCCTCAAGTGGTCATCTTAAGCCTCATCCTACATCTGGCAGATTCTGTAGCTGGTTCTGTAAAGGTTGGTGGAGAGGCAGGTCCATCTGTCACACTACCCTGCCACTACAGTGGAGCTGTCACATCCATGTGCTGGAATAGAGGCTCATGTTCTCTATTCACATGCCAAAATGGCATTGTCTGGACCAATGGAACCCACGTCACCTATCGGAAGGACACACGCTATAAGCTATTGGGGGACCTTTCAAGAAGGGATGTCTCTTTGACCATAGAAAATACAGCTGTGTCTGACAGTGGCGTATATTGTTGCCGTGTTGAGCACCGTGGGTGGTTCAATGACATGAAAATCACCGTATCATTGGAGATTGTGCCACCCAAGGTCACGACTACTCCAATTGTCACAACTGTTCCAACCGTCACGACTGTTCGAACGAGCACCACTGTTCCAACGACAACGACTGTTCCAATGACGACTGTTCCAACGACAACTGTTCCAACAACAATGAGCATTCCAACGACAACGACTGTTCTGACGACAATGACTGTTTCAACGACAACGAGCGTTCCAACGACAACGAGCATTCCAACAACAACAAGTGTTCCAGTGACAACAACTGTCTCTACCTTTGTTCCTCCAATGCCTTTGCCCAGGCAGAACCATGAACCAGTAGCCACTTCACCATCTTCACCTCAGCCAGCAGAAACCCACCCTACGACACTGCAGGGAGCAATAAGGAGAGAACCCACCAGCTCACCATTGTACTCTTACACAACAGATGGGAATGACACCGTGACAGAGTCTTCAGATGGCCTTTGGAATAACAATCAAACTCAACTGTTCCTAGAACATAGTCTACTGACGGCCAATACCACTAAAGGAATCTATGCTGGAGTCTGTATTTCTGTCTTGGTGCTTCTTGCTCTTTTGGGTGTCATCATTGCCAAAATGTTTCATTTAGCAGCCTTCAAATTAAAGCTTTGCAAAATGCAGTTGAAAAGGAAGTCCAAGCAGAAGACAATATCTACATTGAGAATAGTCTTTATGCCACGGACTAAGACCCAGTGGTGCTCTTTGAGAGTTTACGCCCATGAGTGCAGAAGACTGAACAGACATCAGCACATCAGACGTCTTTTAGACCCCAAGACAATTTTTCTGTTTCAGTTTCATCTGGCATTCCAACATGTCAGTGATACTGGGTAG
ORF Protein Sequence MHPQVVILSLILHLADSVAGSVKVGGEAGPSVTLPCHYSGAVTSMCWNRGSCSLFTCQNGIVWTNGTHVTYRKDTRYKLLGDLSRRDVSLTIENTAVSDSGVYCCRVEHRGWFNDMKITVSLEIVPPKVTTTPIVTTVPTVTTVRTSTTVPTTTTVPMTTVPTTTVPTTMSIPTTTTVLTTMTVSTTTSVPTTTSIPTTTSVPVTTTVSTFVPPMPLPRQNHEPVATSPSSPQPAETHPTTLQGAIRREPTSSPLYSYTTDGNDTVTESSDGLWNNNQTQLFLEHSLLTANTTKGIYAGVCISVLVLLALLGVIIAKMFHLAAFKLKLCKMQLKRKSKQKTISTLRIVFMPRTKTQWCSLRVYAHECRRLNRHQHIRRLLDPKTIFLFQFHLAFQHVSDTG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0572-Ab Anti-HAVR1/ HAVCR1/ CD365 monoclonal antibody
    Target Antigen GM-Tg-g-MP0572-Ag HAVCR1 VLP (virus-like particle)
    ORF Viral Vector pGMLP001952 Human HAVCR1 Lentivirus plasmid
    ORF Viral Vector vGMLP001952 Human HAVCR1 Lentivirus particle


    Target information

    Target ID GM-MP0572
    Target Name HAVCR1
    Gene ID 26762, 715333, 101099778, 612069
    Gene Symbol and Synonyms CD365,HAVCR,HAVCR-1,HAVCR1,KIM-1,KIM1,TIM,TIM-1,TIM1,TIMD-1,TIMD1
    Uniprot Accession Q96D42
    Uniprot Entry Name HAVR1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Renal fibrosis, Sickle Cell Nephropathy, Type 1 diabetes mellitus with diabetic nephropathy, Type 2 diabetes mellitus, Vasculitis, Vesicoureteral reflux, Acute kidney failure, Autosomal Dominant Polycystic Kidney Disease, Complications of kidney transplant, Congenital hydronephrosis, Cystic fibrosis with pulmonary manifestations, Injury to Kidney, Intraoperative Renal Injury, Kidney disease, Neonatal urinary tract infection, Nephropathy induced by heavy metals, Proteinuria, Renal cell carcinoma, Hydronephrosis, Coronary artery disease, Nephrotic syndrome with diffuse membranous glomerulonephritis
    Gene Ensembl ENSG00000113249
    Target Classification Not Available

    The protein encoded by this gene is a membrane receptor for both human hepatitis A virus (HHAV) and TIMD4. The encoded protein may be involved in the moderation of asthma and allergic diseases. The reference genome represents an allele that retains a MTTVP amino acid segment that confers protection against atopy in HHAV seropositive individuals. The protein is a receptor for multiple other viruses, including Ebola virus, Marburg virus, Dengue virus, and Zika virus and is a possible entry factor for SARS-CoV-2 and other coronaviruses. [provided by RefSeq, Sep 2021]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.