Human RARA/NR1B1/ RAR ORF/cDNA clone-Lentivirus plasmid (NM_000964.3)
Pre-made Human RARA/NR1B1/ RAR Lentiviral expression plasmid for RARA lentivirus packaging, RARA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to RARA/NR1B1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP001994 | Human RARA Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP001994 |
Gene Name | RARA |
Accession Number | NM_000964.3 |
Gene ID | 5914 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1389 bp |
Gene Alias | NR1B1, RAR |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCCAGCAACAGCAGCTCCTGCCCGACACCTGGGGGCGGGCACCTCAATGGGTACCCGGTGCCTCCCTACGCCTTCTTCTTCCCCCCTATGCTGGGTGGACTCTCCCCGCCAGGCGCTCTGACCACTCTCCAGCACCAGCTTCCAGTTAGTGGATATAGCACACCATCCCCAGCCACCATTGAGACCCAGAGCAGCAGTTCTGAAGAGATAGTGCCCAGCCCTCCCTCGCCACCCCCTCTACCCCGCATCTACAAGCCTTGCTTTGTCTGTCAGGACAAGTCCTCAGGCTACCACTATGGGGTCAGCGCCTGTGAGGGCTGCAAGGGCTTCTTCCGCCGCAGCATCCAGAAGAACATGGTGTACACGTGTCACCGGGACAAGAACTGCATCATCAACAAGGTGACCCGGAACCGCTGCCAGTACTGCCGACTGCAGAAGTGCTTTGAAGTGGGCATGTCCAAGGAGTCTGTGAGAAACGACCGAAACAAGAAGAAGAAGGAGGTGCCCAAGCCCGAGTGCTCTGAGAGCTACACGCTGACGCCGGAGGTGGGGGAGCTCATTGAGAAGGTGCGCAAAGCGCACCAGGAAACCTTCCCTGCCCTCTGCCAGCTGGGCAAATACACTACGAACAACAGCTCAGAACAACGTGTCTCTCTGGACATTGACCTCTGGGACAAGTTCAGTGAACTCTCCACCAAGTGCATCATTAAGACTGTGGAGTTCGCCAAGCAGCTGCCCGGCTTCACCACCCTCACCATCGCCGACCAGATCACCCTCCTCAAGGCTGCCTGCCTGGACATCCTGATCCTGCGGATCTGCACGCGGTACACGCCCGAGCAGGACACCATGACCTTCTCGGACGGGCTGACCCTGAACCGGACCCAGATGCACAACGCTGGCTTCGGCCCCCTCACCGACCTGGTCTTTGCCTTCGCCAACCAGCTGCTGCCCCTGGAGATGGATGATGCGGAGACGGGGCTGCTCAGCGCCATCTGCCTCATCTGCGGAGACCGCCAGGACCTGGAGCAGCCGGACCGGGTGGACATGCTGCAGGAGCCGCTGCTGGAGGCGCTAAAGGTCTACGTGCGGAAGCGGAGGCCCAGCCGCCCCCACATGTTCCCCAAGATGCTAATGAAGATTACTGACCTGCGAAGCATCAGCGCCAAGGGGGCTGAGCGGGTGATCACGCTGAAGATGGAGATCCCGGGCTCCATGCCGCCTCTCATCCAGGAAATGTTGGAGAACTCAGAGGGCCTGGACACTCTGAGCGGACAGCCGGGGGGTGGGGGGCGGGACGGGGGTGGCCTGGCCCCCCCGCCAGGCAGCTGTAGCCCCAGCCTCAGCCCCAGCTCCAACAGAAGCAGCCCGGCCACCCACTCCCCGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T94085-Ab | Anti-RARA/ NR1B1/ RAR monoclonal antibody |
Target Antigen | GM-Tg-g-T94085-Ag | RARA VLP (virus-like particle) |
ORF Viral Vector | pGMLP000651 | Human RARA Lentivirus plasmid |
ORF Viral Vector | pGMLP001994 | Human RARA Lentivirus plasmid |
ORF Viral Vector | pGMAP000217 | Human RARA Adenovirus plasmid |
ORF Viral Vector | vGMLP000651 | Human RARA Lentivirus particle |
ORF Viral Vector | vGMLP001994 | Human RARA Lentivirus particle |
ORF Viral Vector | vGMAP000217 | Human RARA Adenovirus particle |
Target information
Target ID | GM-T94085 |
Target Name | RARA |
Gene ID | 5914, 19401, 700206, 24705, 101083048, 480526, 534280, 100054274 |
Gene Symbol and Synonyms | HS-RARa,NR1B1,RAR,RARA,RARalpha,RARalpha1 |
Uniprot Accession | P10276 |
Uniprot Entry Name | RARA_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000131759 |
Target Classification | Nuclear Receptors, Tumor-associated antigen (TAA) |
This gene represents a nuclear retinoic acid receptor. The encoded protein, retinoic acid receptor alpha, regulates transcription in a ligand-dependent manner. This gene has been implicated in regulation of development, differentiation, apoptosis, granulopoeisis, and transcription of clock genes. Translocations between this locus and several other loci have been associated with acute promyelocytic leukemia. Alternatively spliced transcript variants have been found for this locus.[provided by RefSeq, Sep 2010]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.