Human TPH1/TPRH/ TRPH ORF/cDNA clone-Lentivirus plasmid (NM_004179.2 )
Pre-made Human TPH1/TPRH/ TRPH Lentiviral expression plasmid for TPH1 lentivirus packaging, TPH1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to TPH1/TPRH products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP002012 | Human TPH1 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP002012 |
Gene Name | TPH1 |
Accession Number | NM_004179.2 |
Gene ID | 7166 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1335 bp |
Gene Alias | TPRH, TRPH |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGATTGAAGACAATAAGGAGAACAAAGACCATTCCTTAGAAAGGGGAAGAGCAAGTCTCATTTTTTCCTTAAAGAATGAAGTTGGAGGACTTATAAAAGCCCTGAAAATCTTTCAGGAGAAGCATGTGAATCTGTTACATATCGAGTCCCGAAAATCAAAAAGAAGAAACTCAGAATTTGAGATTTTTGTTGACTGTGACATCAACAGAGAACAATTGAATGATATTTTTCATCTGCTGAAGTCTCATACCAATGTTCTCTCTGTGAATCTACCAGATAATTTTACTTTGAAGGAAGATGGTATGGAAACTGTTCCTTGGTTTCCAAAGAAGATTTCTGACCTGGACCATTGTGCCAACAGAGTTCTGATGTATGGATCTGAACTAGATGCAGACCATCCTGGCTTCAAAGACAATGTCTACCGTAAACGTCGAAAGTATTTTGCGGACTTGGCTATGAACTATAAACATGGAGACCCCATTCCAAAGGTTGAATTCACTGAAGAGGAGATTAAGACCTGGGGAACCGTATTCCAAGAGCTCAACAAACTCTACCCAACCCATGCTTGCAGAGAGTATCTCAAAAACTTACCTTTGCTTTCTAAATATTGTGGATATCGGGAGGATAATATCCCACAATTGGAAGATGTCTCCAACTTTTTAAAAGAGCGTACAGGTTTTTCCATCCGTCCTGTGGCTGGTTACTTATCACCAAGAGATTTCTTATCAGGTTTAGCCTTTCGAGTTTTTCACTGCACTCAATATGTGAGACACAGTTCAGATCCCTTCTATACCCCAGAGCCAGATACCTGCCATGAACTCTTAGGTCATGTCCCGCTTTTGGCTGAACCTAGTTTTGCCCAATTCTCCCAAGAAATTGGCTTGGCTTCTCTTGGCGCTTCAGAGGAGGCTGTTCAAAAACTGGCAACGTGCTACTTTTTCACTGTGGAGTTTGGTCTATGTAAACAAGATGGACAGCTAAGAGTCTTTGGTGCTGGCTTACTTTCTTCTATCAGTGAACTCAAACATGCACTTTCTGGACATGCCAAAGTAAAGCCCTTTGATCCCAAGATTACCTGCAAACAGGAATGTCTTATCACAACTTTTCAAGATGTCTACTTTGTATCTGAAAGTTTTGAAGATGCAAAGGAGAAGATGAGAGAATTTACCAAAACAATTAAGCGTCCATTTGGAGTGAAGTATAATCCATATACACGGAGTATTCAGATCCTGAAAGACACCAAGAGCATAACCAGTGCCATGAATGAGCTGCAGCATGATCTCGATGTTGTCAGTGATGCCCTTGCTAAGGTCAGCAGGAAGCCGAGTATCTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T78915-Ab | Anti-TPH1 monoclonal antibody |
Target Antigen | GM-Tg-g-T78915-Ag | TPH1 protein |
ORF Viral Vector | pGMLV001226 | Rat Tph1 Lentivirus plasmid |
ORF Viral Vector | pGMLP002012 | Human TPH1 Lentivirus plasmid |
ORF Viral Vector | pGMAP000485 | Human TPH1 Adenovirus plasmid |
ORF Viral Vector | vGMLV001226 | Rat Tph1 Lentivirus particle |
ORF Viral Vector | vGMLP002012 | Human TPH1 Lentivirus particle |
ORF Viral Vector | vGMAP000485 | Human TPH1 Adenovirus particle |
Target information
Target ID | GM-T78915 |
Target Name | TPH1 |
Gene ID | 7166, 21990, 695363, 24848, 101098575, 611956, 781941, 100056614 |
Gene Symbol and Synonyms | Tph,TPH1,TPRH,TRPH |
Uniprot Accession | P17752 |
Uniprot Entry Name | TPH1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target, Immuno-oncology Target |
Disease | Not Available |
Gene Ensembl | ENSG00000129167 |
Target Classification | Checkpoint-Immuno Oncology |
This gene encodes a member of the aromatic amino acid hydroxylase family. The encoded protein catalyzes the first and rate limiting step in the biosynthesis of serotonin, an important hormone and neurotransmitter. Mutations in this gene have been associated with an elevated risk for a variety of diseases and disorders, including schizophrenia, somatic anxiety, anger-related traits, bipolar disorder, suicidal behavior, addictions, and others.[provided by RefSeq, Apr 2009]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.