Human TPH1 ORF/cDNA clone-Adenovirus particle (BC106739)

Pre-made Human TPH1/ Adenovirus for TPH1 overexpression in-vitro and in-vivo. The TPH1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified TPH1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to TPH1/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000485 Human TPH1 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000485
Gene Name TPH1
Accession Number BC106739
Gene ID 7166
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1335 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGATTGAAGACAATAAGGAGAACAAAGACCATTCCTTAGAAAGGGGAAGAGCAAGTCTCATTTTTTCCTTAAAGAATGAAGTTGGAGGACTTATAAAAGCCCTGAAAATCTTTCAGGAGAAGCATGTGAATCTGTTACATATCGAGTCCCGAAAATCAAAAAGAAGAAACTCAGAATTTGAGATTTTTGTTGACTGTGACATCAACAGAGAACAATTGAATGATATTTTTCATCTGCTGAAGTCTCATACCAATGTTCTCTCTGTGAATCTACCAGATAATTTTACTTTGAAGGAAGATGGTATGGAAACTGTTCCTTGGTTTCCAAAGAAGATTTCTGACCTGGACCATTGTGCCAACAGAGTTCTGATGTATGGATCTGAACTAGATGCAGACCATCCTGGCTTCAAAGACAATGTCTACCGTAAACGTCGAAAGTATTTTGCGGACTTGGCTATGAACTATAAACATGGAGACCCCATTCCAAAGGTTGAATTCACTGAAGAGGAGATTAAGACCTGGGGAACCGTATTCCAAGAGCTCAACAAACTCTACCCAACCCATGCTTGCAGAGAGTATCTCAAAAACTTACCTTTGCTTTCTAAATATTGTGGATATCGGGAGGATAATATCCCACAATTGGAAGATGTCTCCAACTTTTTAAAAGAGCGTACAGGTTTTTCCATCCGTCCTGTGGCTGGTTACTTATCACCAAGAGATTTCTTATCAGGTTTAGCCTTTCGAGTTTTTCACTGCACTCAATATGTGAGACACAGTTCAGATCCCTTCTATACCCCAGAGCCAGATACCTGCCATGAACTCTTAGGTCATGTCCCGCTTTTGGCTGAACCTAGTTTTGCCCAATTCTCCCAAGAAATTGGCTTGGCTTCTCTTGGCGCTTCAGAGGAGGCTGTTCAAAAACTGGCAACGTGCTACTTTTTCACTGTGGAGTTTGGTCTATGTAAACAAGATGGACAGCTAAGAGTCTTTGGTGCTGGCTTACTTTCTTCTATCAGTGAACTCAAACATGCACTTTCTGGACATGCCAAAGTAAAGCCCTTTGATCCCAAGATTACCTGCAAACAGGAATGTCTTATCACAACTTTTCAAGATGTCTACTTTGTATCTGAAAGTTTTGAAGATGCAAAGGAGAAGATGAGAGAATTTACCAAAACAATTAAGCGTCCATTTGGAGTGAAGTATAATCCATATACACGGAGTATTCAGATCCTGAAAGACACCAAGAGCATAACCAGTGCCATGAATGAGCTGCAGCATGATCTCGATGTTGTCAGTGATGCCCTTGCTAAGGTCAGCAGGAAGCCGAGTATCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T78915-Ab Anti-TPH1 monoclonal antibody
    Target Antigen GM-Tg-g-T78915-Ag TPH1 protein
    ORF Viral Vector pGMLV001226 Rat Tph1 Lentivirus plasmid
    ORF Viral Vector pGMLP002012 Human TPH1 Lentivirus plasmid
    ORF Viral Vector pGMAP000485 Human TPH1 Adenovirus plasmid
    ORF Viral Vector vGMLV001226 Rat Tph1 Lentivirus particle
    ORF Viral Vector vGMLP002012 Human TPH1 Lentivirus particle
    ORF Viral Vector vGMAP000485 Human TPH1 Adenovirus particle


    Target information

    Target ID GM-T78915
    Target Name TPH1
    Gene ID 7166, 21990, 695363, 24848, 101098575, 611956, 781941, 100056614
    Gene Symbol and Synonyms Tph,TPH1,TPRH,TRPH
    Uniprot Accession P17752
    Uniprot Entry Name TPH1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Not Available
    Gene Ensembl ENSG00000129167
    Target Classification Checkpoint-Immuno Oncology

    This gene encodes a member of the aromatic amino acid hydroxylase family. The encoded protein catalyzes the first and rate limiting step in the biosynthesis of serotonin, an important hormone and neurotransmitter. Mutations in this gene have been associated with an elevated risk for a variety of diseases and disorders, including schizophrenia, somatic anxiety, anger-related traits, bipolar disorder, suicidal behavior, addictions, and others.[provided by RefSeq, Apr 2009]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.