Human CSF2RA/alphaGMR/ CD116 ORF/cDNA clone-Lentivirus plasmid (NM_006140)

Pre-made Human CSF2RA/alphaGMR/ CD116 Lentiviral expression plasmid for CSF2RA lentivirus packaging, CSF2RA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to CSF2RA/alphaGMR products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002066 Human CSF2RA Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002066
Gene Name CSF2RA
Accession Number NM_006140
Gene ID 1438
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1203 bp
Gene Alias alphaGMR, CD116, CDw116, CSF2R, CSF2RAX, CSF2RAY, CSF2RX, CSF2RY, GM-CSF-R-alpha, GMCSFR, GMR, SMDP4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCTTCTCCTGGTGACAAGCCTTCTGCTCTGTGAGTTACCACACCCAGCATTCCTCCTGATCCCAGAGAAATCGGATCTGCGAACAGTGGCACCAGCCTCTAGTCTCAATGTGAGGTTTGACTCCAGGACGATGAATTTAAGCTGGGACTGCCAAGAAAACACAACCTTCAGCAAGTGTTTCTTAACTGACAAGAAGAACAGAGTCGTGGAACCCAGGCTCAGTAACAACGAATGTTCGTGCACATTTCGTGAAATTTGTCTGCATGAAGGAGTCACATTTGAGGTTCACGTGAATACTAGTCAAAGAGGATTTCAACAGAAACTGCTTTATCCAAATTCAGGAAGGGAGGGTACCGCTGCTCAGAATTTCTCCTGTTTCATCTACAATGCGGATTTAATGAACTGTACCTGGGCGAGGGGTCCGACGGCCCCCCGTGACGTCCAGTATTTTTTGTACATACGAAACTCAAAGAGAAGGAGGGAGATCCGGTGTCCTTATTACATACAAGACTCAGGAACCCATGTGGGATGTCACCTGGATAACCTGTCAGGATTAACGTCTCGCAATTACTTTCTGGTTAACGGAACCAGCCGAGAAATTGGCATCCAATTCTTTGATTCACTTTTGGACACAAAGAAAATAGAACGATTCAACCCTCCCAGCAATGTCACCGTACGTTGCAACACGACGCACTGCCTCGTACGGTGGAAACAGCCCAGGACCTATCAGAAGCTGTCGTACCTGGACTTTCAGTACCAGCTGGACGTCCACAGAAAGAATACCCAGCCTGGCACGGAAAACCTACTGATTAATGTTTCTGGTGATTTGGAAAATAGATACAACTTTCCAAGCTCTGAGCCCAGAGCAAAACACAGTGTGAAGATCAGAGCTGCAGACGTCCGCATCTTGAATTGGAGCTCCTGGAGTGAAGCCATTGAATTTGGTTCTGACGACGGGAACCTCGGCTCTGTGTACATTTATGTGCTCCTAATCGTGGGAACCCTTGTCTGTGGCATCGTCCTCGGCTTCCTCTTTAAAAGGTTCCTTAGGATACAGCGGCTGTTCCCGCCAGTTCCACAGATCAAAGACAAACTGAATGATAACCATGAGGTGGAAGACGAGATCATCTGGGAGGAATTCACCCCAGAGGAAGGGAAAGGCTACCGCGAAGAGGTCTTGACCGTGAAGGAAATTACCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-986 Pre-Made Sargramostim Biosimilar, Recombinant Protein targeting CSF2RA: Recombinant therapeutic protein targeting CD116/CDw116/CSF2R/CSF2RAX/CSF2RAY/CSF2RX/CSF2RY/GM-CSF-R-alpha/GMCSFR/GMCSFR-alpha/GMR/GMR-alpha/SMDP4/alphaGMR
    Biosimilar GMP-Bios-ab-339 Pre-Made Mavrilimumab biosimilar, Whole mAb, Anti-CSF2RA Antibody: Anti-GMR/CD116/CSF2R/SMDP4/CDw116GMR-alpha/GMCSFR-alpha/GM-CSF-R-alpha therapeutic antibody
    Target Antibody GM-Tg-g-T73097-Ab Anti-CSF2R/ CSF2RA/ CD116 monoclonal antibody
    Target Antigen GM-Tg-g-T73097-Ag CSF2RA VLP (virus-like particle)
    ORF Viral Vector pGMLP002066 Human CSF2RA Lentivirus plasmid
    ORF Viral Vector vGMLP002066 Human CSF2RA Lentivirus particle


    Target information

    Target ID GM-T73097
    Target Name CSF2RA
    Gene ID 1438, 609266, 100336606
    Gene Symbol and Synonyms alphaGMR,CD116,CDw116,CSF2R,CSF2RA,CSF2RAX,CSF2RAY,CSF2RX,CSF2RY,GM-CSF-R-alpha,GMCSFR,GMCSFR-alpha,GMR,GMR-alpha,SMDP4
    Uniprot Accession P15509
    Uniprot Entry Name CSF2R_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease Not Available
    Gene Ensembl ENSG00000198223
    Target Classification Checkpoint-Immuno Oncology

    The protein encoded by this gene is the alpha subunit of the heterodimeric receptor for colony stimulating factor 2, a cytokine which controls the production, differentiation, and function of granulocytes and macrophages. The encoded protein is a member of the cytokine family of receptors. This gene is found in the pseudoautosomal region (PAR) of the X and Y chromosomes. Multiple transcript variants encoding different isoforms have been found for this gene, with some of the isoforms being membrane-bound and others being soluble. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.