Human DIO1/5DI/ TXDI1 ORF/cDNA clone-Lentivirus plasmid (NM_000792)
Pre-made Human DIO1/5DI/ TXDI1 Lentiviral expression plasmid for DIO1 lentivirus packaging, DIO1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to DIO1/5DI products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP002080 | Human DIO1 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP002080 |
Gene Name | DIO1 |
Accession Number | NM_000792 |
Gene ID | 1733 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 750 bp |
Gene Alias | 5DI, TXDI1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGGCTGCCCCAGCCAGGGCTGTGGCTGAAGAGGCTCTGGGTGCTCTTGGAGGTGGCTGTGCATGTGGTCGTGGGTAAAGTGCTTCTGATATTGTTTCCAGACAGAGTCAAGCGGAACATCCTGGCCATGGGCGAGAAGACGGGTATGACCAGGAACCCCCATTTCAGCCACGACAACTGGATACCAACCTTTTTCAGCACCCAGTATTTCTGGTTCGTCTTGAAGGTCCGTTGGCAGCGACTAGAGGACACGACTGAGCTAGGGGGTCTGGCCCCAAACTGCCCGGTGGTCCGCCTCTCAGGACAGAGGTGCAACATTTGGGAGTTTATGCAAGGTAATAGGCCACTGGTGCTGAATTTTGGAAGTTGTACCTGACCTTCATTTATGTTCAAATTTGACCAGTTCAAGAGGCTTATTGAAGACTTTAGTTCCATAGCAGATTTTCTTGTCATTTACATTGAAGAAGCACATGCATCAGATGGCTGGGCTTTTAAGAACAACATGGACATCAGAAATCACCAGAACCTTCAGGATCGCCTGCAGGCAGCCCATCTACTGCTGGCCAGGAGCCCCCAGTGCCCTGTGGTGGTGGACACCATGCAGAACCAGAGCAGCCAGCTCTACGCAGCACTGCCTGAGAGGCTCTACATAATCCAGGAGGGCAGGATCCTCTACAAGGGTAAATCTGGCCCTTGGAACTACAACCCAGAGGAAGTTCGTGCTGTTCTGGAAAAGCTCCACAGTTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T16792-Ab | Anti-IOD1/ DIO1/ 5DI monoclonal antibody |
Target Antigen | GM-Tg-g-T16792-Ag | DIO1 VLP (virus-like particle) |
ORF Viral Vector | pGMLP002080 | Human DIO1 Lentivirus plasmid |
ORF Viral Vector | vGMLP002080 | Human DIO1 Lentivirus particle |
Target information
Target ID | GM-T16792 |
Target Name | DIO1 |
Gene ID | 1733, 13370, 714739, 25430, 493798, 403635, 782446, 100050359 |
Gene Symbol and Synonyms | 5DI,D1,DIO1,DIOI,ITDI1,THMA2,TXDI1 |
Uniprot Accession | P49895 |
Uniprot Entry Name | IOD1_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000211452 |
Target Classification | Not Available |
The protein encoded by this gene belongs to the iodothyronine deiodinase family. It catalyzes the activation, as well as the inactivation of thyroid hormone by outer and inner ring deiodination, respectively. The activation reaction involves the conversion of the prohormone thyroxine (3,5,3',5'-tetraiodothyronine, T4), secreted by the thyroid gland, to the bioactive thyroid hormone (3,5,3'-triiodothyronine, T3) by 5'-deiodination. This protein provides most of the circulating T3, which is essential for growth, differentiation and basal metabolism in vertebrates. This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2018]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.