Human DIO1/5DI/ TXDI1 ORF/cDNA clone-Lentivirus plasmid (NM_000792)

Pre-made Human DIO1/5DI/ TXDI1 Lentiviral expression plasmid for DIO1 lentivirus packaging, DIO1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to DIO1/5DI products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002080 Human DIO1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002080
Gene Name DIO1
Accession Number NM_000792
Gene ID 1733
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 750 bp
Gene Alias 5DI, TXDI1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGGCTGCCCCAGCCAGGGCTGTGGCTGAAGAGGCTCTGGGTGCTCTTGGAGGTGGCTGTGCATGTGGTCGTGGGTAAAGTGCTTCTGATATTGTTTCCAGACAGAGTCAAGCGGAACATCCTGGCCATGGGCGAGAAGACGGGTATGACCAGGAACCCCCATTTCAGCCACGACAACTGGATACCAACCTTTTTCAGCACCCAGTATTTCTGGTTCGTCTTGAAGGTCCGTTGGCAGCGACTAGAGGACACGACTGAGCTAGGGGGTCTGGCCCCAAACTGCCCGGTGGTCCGCCTCTCAGGACAGAGGTGCAACATTTGGGAGTTTATGCAAGGTAATAGGCCACTGGTGCTGAATTTTGGAAGTTGTACCTGACCTTCATTTATGTTCAAATTTGACCAGTTCAAGAGGCTTATTGAAGACTTTAGTTCCATAGCAGATTTTCTTGTCATTTACATTGAAGAAGCACATGCATCAGATGGCTGGGCTTTTAAGAACAACATGGACATCAGAAATCACCAGAACCTTCAGGATCGCCTGCAGGCAGCCCATCTACTGCTGGCCAGGAGCCCCCAGTGCCCTGTGGTGGTGGACACCATGCAGAACCAGAGCAGCCAGCTCTACGCAGCACTGCCTGAGAGGCTCTACATAATCCAGGAGGGCAGGATCCTCTACAAGGGTAAATCTGGCCCTTGGAACTACAACCCAGAGGAAGTTCGTGCTGTTCTGGAAAAGCTCCACAGTTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T16792-Ab Anti-IOD1/ DIO1/ 5DI monoclonal antibody
    Target Antigen GM-Tg-g-T16792-Ag DIO1 VLP (virus-like particle)
    ORF Viral Vector pGMLP002080 Human DIO1 Lentivirus plasmid
    ORF Viral Vector vGMLP002080 Human DIO1 Lentivirus particle


    Target information

    Target ID GM-T16792
    Target Name DIO1
    Gene ID 1733, 13370, 714739, 25430, 493798, 403635, 782446, 100050359
    Gene Symbol and Synonyms 5DI,D1,DIO1,DIOI,ITDI1,THMA2,TXDI1
    Uniprot Accession P49895
    Uniprot Entry Name IOD1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000211452
    Target Classification Not Available

    The protein encoded by this gene belongs to the iodothyronine deiodinase family. It catalyzes the activation, as well as the inactivation of thyroid hormone by outer and inner ring deiodination, respectively. The activation reaction involves the conversion of the prohormone thyroxine (3,5,3',5'-tetraiodothyronine, T4), secreted by the thyroid gland, to the bioactive thyroid hormone (3,5,3'-triiodothyronine, T3) by 5'-deiodination. This protein provides most of the circulating T3, which is essential for growth, differentiation and basal metabolism in vertebrates. This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2018]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.