Human P2RY2/HP2U/P2RU1 ORF/cDNA clone-Lentivirus plasmid (NM_002564)
Cat. No.: pGMLP002151
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human P2RY2/HP2U/P2RU1 Lentiviral expression plasmid for P2RY2 lentivirus packaging, P2RY2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
P2RY2/HP2U products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP002151 |
Gene Name | P2RY2 |
Accession Number | NM_002564 |
Gene ID | 5029 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1134 bp |
Gene Alias | HP2U,P2RU1,P2U,P2U1,P2UR,P2Y2,P2Y2R |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCAGCAGACCTGGGCCCCTGGAATGACACCATCAATGGCACCTGGGATGGGGATGAGCTGGGCTACAGGTGCCGCTTCAACGAGGACTTCAAGTACGTGCTGCTGCCTGTGTCCTACGGCGTGGTGTGCGTGCCTGGGCTGTGTCTGAACGCCGTGGCGCTCTACATCTTCTTGTGCCGCCTCAAGACCTGGAATGCGTCCACCACATATATGTTCCACCTGGCTGTGTCTGATGCACTGTATGCGGCCTCCCTGCCGCTGCTGGTCTATTACTACGCCCGCGGCGACCACTGGCCCTTCAGCACGGTGCTCTGCAAGCTGGTGCGCTTCCTCTTCTACACCAACCTTTACTGCAGCATCCTCTTCCTCACCTGCATCAGCGTGCACCGGTGTCTGGGCGTCTTACGACCTCTGCGCTCCCTGCGCTGGGGCCGGGCCCGCTACGCTCGCCGGGTGGCCGGGGCCGTGTGGGTGTTGGTGCTGGCCTGCCAGGCCCCCGTGCTCTACTTTGTCACCACCAGCGCGCGCGGGGGCCGCGTAACCTGCCACGACACCTCGGCACCCGAGCTCTTCAGCCGCTTCGTGGCCTACAGCTCAGTCATGCTGGGCCTGCTCTTCGCGGTGCCCTTTGCCGTCATCCTTGTCTGTTACGTGCTCATGGCTCGGCGACTGCTAAAGCCAGCCTACGGGACCTCGGGCGGCCTGCCTAGGGCCAAGCGCAAGTCCGTGCGCACCATCGCCGTGGTGCTGGCTGTCTTCGCCCTCTGCTTCCTGCCATTCCACGTCACCCGCACCCTCTACTACTCCTTCCGCTCGCTGGACCTCAGCTGCCACACCCTCAACGCCATCAACATGGCCTACAAGGTTACCCGGCCGCTGGCCAGTGCTAACAGTTGCCTTGACCCCGTGCTCTACTTCCTGGCTGGGCAGAGGCTCGTACGCTTTGCCCGAGATGCCAAGCCACCCACTGGCCCCAGCCCTGCCACCCCGGCTCGCCGCAGGCTGGGCCTGCGCAGATCCGACAGAACTGACATGCAGAGGATAGAAGATGTGTTGGGCAGCAGTGAGGACTCTAGGCGGACAGAGTCCACGCCGGCTGGTAGCGAGAACACTAAGGACATTCGGCTGTAG |
ORF Protein Sequence | MAADLGPWNDTINGTWDGDELGYRCRFNEDFKYVLLPVSYGVVCVPGLCLNAVALYIFLCRLKTWNASTTYMFHLAVSDALYAASLPLLVYYYARGDHWPFSTVLCKLVRFLFYTNLYCSILFLTCISVHRCLGVLRPLRSLRWGRARYARRVAGAVWVLVLACQAPVLYFVTTSARGGRVTCHDTSAPELFSRFVAYSSVMLGLLFAVPFAVILVCYVLMARRLLKPAYGTSGGLPRAKRKSVRTIAVVLAVFALCFLPFHVTRTLYYSFRSLDLSCHTLNAINMAYKVTRPLASANSCLDPVLYFLAGQRLVRFARDAKPPTGPSPATPARRRLGLRRSDRTDMQRIEDVLGSSEDSRRTESTPAGSENTKDIRL |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T93515-Ab | Anti-P2RY2/ HP2U/ P2RU1 monoclonal antibody |
Target Antigen | GM-Tg-g-T93515-Ag | P2RY2 VLP (virus-like particle) |
ORF Viral Vector | pGMLP002151 | Human P2RY2 Lentivirus plasmid |
ORF Viral Vector | vGMLP002151 | Human P2RY2 Lentivirus particle |
Target information
Target ID | GM-T93515 |
Target Name | P2RY2 |
Gene ID | 5029, 18442, 718603, 29597, 101099323, 485203, 282638, 100065753 |
Gene Symbol and Synonyms | HP2U,P2RU1,P2RY2,P2U,P2U1,P2UR,P2Y2,P2Y2R |
Uniprot Accession | P41231 |
Uniprot Entry Name | P2RY2_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000175591 |
Target Classification | GPCR |
The product of this gene belongs to the family of P2 receptors, which is activated by extracellular nucleotides and subdivided into P2X ligand-gated ion channels and P2Y G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor, found on many cell types, is activated by ATP and UTP and is reported to be overexpressed on some cancer cell types. It is involved in many cellular functions, such as proliferation, apoptosis and inflammation. Three transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Mar 2013]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.