Human P2RY2/HP2U/P2RU1 ORF/cDNA clone-Lentivirus particle (NM_002564)

Cat. No.: vGMLP002151

Pre-made Human P2RY2/HP2U/P2RU1 Lentiviral expression plasmid for P2RY2 lentivirus packaging, P2RY2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to P2RY2/HP2U products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002151 Human P2RY2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002151
Gene Name P2RY2
Accession Number NM_002564
Gene ID 5029
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1134 bp
Gene Alias HP2U,P2RU1,P2U,P2U1,P2UR,P2Y2,P2Y2R
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCAGCAGACCTGGGCCCCTGGAATGACACCATCAATGGCACCTGGGATGGGGATGAGCTGGGCTACAGGTGCCGCTTCAACGAGGACTTCAAGTACGTGCTGCTGCCTGTGTCCTACGGCGTGGTGTGCGTGCCTGGGCTGTGTCTGAACGCCGTGGCGCTCTACATCTTCTTGTGCCGCCTCAAGACCTGGAATGCGTCCACCACATATATGTTCCACCTGGCTGTGTCTGATGCACTGTATGCGGCCTCCCTGCCGCTGCTGGTCTATTACTACGCCCGCGGCGACCACTGGCCCTTCAGCACGGTGCTCTGCAAGCTGGTGCGCTTCCTCTTCTACACCAACCTTTACTGCAGCATCCTCTTCCTCACCTGCATCAGCGTGCACCGGTGTCTGGGCGTCTTACGACCTCTGCGCTCCCTGCGCTGGGGCCGGGCCCGCTACGCTCGCCGGGTGGCCGGGGCCGTGTGGGTGTTGGTGCTGGCCTGCCAGGCCCCCGTGCTCTACTTTGTCACCACCAGCGCGCGCGGGGGCCGCGTAACCTGCCACGACACCTCGGCACCCGAGCTCTTCAGCCGCTTCGTGGCCTACAGCTCAGTCATGCTGGGCCTGCTCTTCGCGGTGCCCTTTGCCGTCATCCTTGTCTGTTACGTGCTCATGGCTCGGCGACTGCTAAAGCCAGCCTACGGGACCTCGGGCGGCCTGCCTAGGGCCAAGCGCAAGTCCGTGCGCACCATCGCCGTGGTGCTGGCTGTCTTCGCCCTCTGCTTCCTGCCATTCCACGTCACCCGCACCCTCTACTACTCCTTCCGCTCGCTGGACCTCAGCTGCCACACCCTCAACGCCATCAACATGGCCTACAAGGTTACCCGGCCGCTGGCCAGTGCTAACAGTTGCCTTGACCCCGTGCTCTACTTCCTGGCTGGGCAGAGGCTCGTACGCTTTGCCCGAGATGCCAAGCCACCCACTGGCCCCAGCCCTGCCACCCCGGCTCGCCGCAGGCTGGGCCTGCGCAGATCCGACAGAACTGACATGCAGAGGATAGAAGATGTGTTGGGCAGCAGTGAGGACTCTAGGCGGACAGAGTCCACGCCGGCTGGTAGCGAGAACACTAAGGACATTCGGCTGTAG
ORF Protein Sequence MAADLGPWNDTINGTWDGDELGYRCRFNEDFKYVLLPVSYGVVCVPGLCLNAVALYIFLCRLKTWNASTTYMFHLAVSDALYAASLPLLVYYYARGDHWPFSTVLCKLVRFLFYTNLYCSILFLTCISVHRCLGVLRPLRSLRWGRARYARRVAGAVWVLVLACQAPVLYFVTTSARGGRVTCHDTSAPELFSRFVAYSSVMLGLLFAVPFAVILVCYVLMARRLLKPAYGTSGGLPRAKRKSVRTIAVVLAVFALCFLPFHVTRTLYYSFRSLDLSCHTLNAINMAYKVTRPLASANSCLDPVLYFLAGQRLVRFARDAKPPTGPSPATPARRRLGLRRSDRTDMQRIEDVLGSSEDSRRTESTPAGSENTKDIRL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T93515-Ab Anti-P2RY2/ HP2U/ P2RU1 monoclonal antibody
    Target Antigen GM-Tg-g-T93515-Ag P2RY2 VLP (virus-like particle)
    ORF Viral Vector pGMLP002151 Human P2RY2 Lentivirus plasmid
    ORF Viral Vector vGMLP002151 Human P2RY2 Lentivirus particle


    Target information

    Target ID GM-T93515
    Target Name P2RY2
    Gene ID 5029, 18442, 718603, 29597, 101099323, 485203, 282638, 100065753
    Gene Symbol and Synonyms HP2U,P2RU1,P2RY2,P2U,P2U1,P2UR,P2Y2,P2Y2R
    Uniprot Accession P41231
    Uniprot Entry Name P2RY2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000175591
    Target Classification GPCR

    The product of this gene belongs to the family of P2 receptors, which is activated by extracellular nucleotides and subdivided into P2X ligand-gated ion channels and P2Y G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor, found on many cell types, is activated by ATP and UTP and is reported to be overexpressed on some cancer cell types. It is involved in many cellular functions, such as proliferation, apoptosis and inflammation. Three transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Mar 2013]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.