Human SFN/YWHAS ORF/cDNA clone-Lentivirus plasmid (NM_006142)
Pre-made Human SFN/YWHAS Lentiviral expression plasmid for SFN lentivirus packaging, SFN lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to SFN/YWHAS products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP002188 | Human SFN Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP002188 |
Gene Name | SFN |
Accession Number | NM_006142 |
Gene ID | 2810 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 747 bp |
Gene Alias | YWHAS |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGAGAGAGCCAGTCTGATCCAGAAGGCCAAGCTGGCAGAGCAGGCCGAACGCTATGAGGACATGGCAGCCTTCATGAAAGGCGCCGTGGAGAAGGGCGAGGAGCTCTCCTGCGAAGAGCGAAACCTGCTCTCAGTAGCCTATAAGAACGTGGTGGGCGGCCAGAGGGCTGCCTGGAGGGTGCTGTCCAGTATTGAGCAGAAAAGCAACGAGGAGGGCTCGGAGGAGAAGGGGCCCGAGGTGCGTGAGTACCGGGAGAAGGTGGAGACTGAGCTCCAGGGCGTGTGCGACACCGTGCTGGGCCTGCTGGACAGCCACCTCATCAAGGAGGCCGGGGACGCCGAGAGCCGGGTCTTCTACCTGAAGATGAAGGGTGACTACTACCGCTACCTGGCCGAGGTGGCCACCGGTGACGACAAGAAGCGCATCATTGACTCAGCCCGGTCAGCCTACCAGGAGGCCATGGACATCAGCAAGAAGGAGATGCCGCCCACCAACCCCATCCGCCTGGGCCTGGCCCTGAACTTTTCCGTCTTCCACTACGAGATCGCCAACAGCCCCGAGGAGGCCATCTCTCTGGCCAAGACCACTTTCGACGAGGCCATGGCTGATCTGCACACCCTCAGCGAGGACTCCTACAAAGACAGCACCCTCATCATGCAGCTGCTGCGAGACAACCTGACACTGTGGACGGCCGACAACGCCGGGGAAGAGGGGGGCGAGGCTCCCCAGGAGCCCCAGAGCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1283-Ab | Anti-1433S/ SFN/ YWHAS functional antibody |
Target Antigen | GM-Tg-g-SE1283-Ag | SFN protein |
ORF Viral Vector | pGMPC000161 | Human SFN Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP002188 | Human SFN Lentivirus plasmid |
ORF Viral Vector | vGMLP002188 | Human SFN Lentivirus particle |
Target information
Target ID | GM-SE1283 |
Target Name | SFN |
Gene ID | 2810, 55948, 715055, 313017, 101087501, 487351, 528453, 100057082 |
Gene Symbol and Synonyms | 14-3-3,Er,Mme1,SFN,YWHAS |
Uniprot Accession | P31947 |
Uniprot Entry Name | 1433S_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000175793 |
Target Classification | Not Available |
This gene encodes a cell cycle checkpoint protein. The encoded protein binds to translation and initiation factors and functions as a regulator of mitotic translation. In response to DNA damage this protein plays a role in preventing DNA errors during mitosis. [provided by RefSeq, Aug 2017]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.