Human SFN/YWHAS ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_006142.5)

Pre-made Human SFN/YWHAS Non-Viral expression plasmid (overexpression vector) for mouse SFN overexpression in unique cell transient transfection and stable cell line development.

Target products collectionGo to SFN/YWHAS products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMPC000161 Human SFN Mammalian (Non-Viral Vector) plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMPC000161
Gene Name SFN
Accession Number NM_006142.5
Gene ID 2810
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 747 bp
Gene Alias YWHAS
Fluorescent Reporter EGFP
Mammalian Cell Selection
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAGAGAGCCAGTCTGATCCAGAAGGCCAAGCTGGCAGAGCAGGCCGAACGCTATGAGGACATGGCAGCCTTCATGAAAGGCGCCGTGGAGAAGGGCGAGGAGCTCTCCTGCGAAGAGCGAAACCTGCTCTCAGTAGCCTATAAGAACGTGGTGGGCGGCCAGAGGGCTGCCTGGAGGGTGCTGTCCAGTATTGAGCAGAAAAGCAACGAGGAGGGCTCGGAGGAGAAGGGGCCCGAGGTGCGTGAGTACCGGGAGAAGGTGGAGACTGAGCTCCAGGGCGTGTGCGACACCGTGCTGGGCCTGCTGGACAGCCACCTCATCAAGGAGGCCGGGGACGCCGAGAGCCGGGTCTTCTACCTGAAGATGAAGGGTGACTACTACCGCTACCTGGCCGAGGTGGCCACCGGTGACGACAAGAAGCGCATCATTGACTCAGCCCGGTCAGCCTACCAGGAGGCCATGGACATCAGCAAGAAGGAGATGCCGCCCACCAACCCCATCCGCCTGGGCCTGGCCCTGAACTTTTCCGTCTTCCACTACGAGATCGCCAACAGCCCCGAGGAGGCCATCTCTCTGGCCAAGACCACTTTCGACGAGGCCATGGCTGATCTGCACACCCTCAGCGAGGACTCCTACAAAGACAGCACCCTCATCATGCAGCTGCTGCGAGACAACCTGACACTGTGGACGGCCGACAACGCCGGGGAAGAGGGGGGCGAGGCTCCCCAGGAGCCCCAGAGCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1283-Ab Anti-1433S/ SFN/ YWHAS functional antibody
    Target Antigen GM-Tg-g-SE1283-Ag SFN protein
    ORF Viral Vector pGMPC000161 Human SFN Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP002188 Human SFN Lentivirus plasmid
    ORF Viral Vector vGMLP002188 Human SFN Lentivirus particle


    Target information

    Target ID GM-SE1283
    Target Name SFN
    Gene ID 2810, 55948, 715055, 313017, 101087501, 487351, 528453, 100057082
    Gene Symbol and Synonyms 14-3-3,Er,Mme1,SFN,YWHAS
    Uniprot Accession P31947
    Uniprot Entry Name 1433S_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000175793
    Target Classification Not Available

    This gene encodes a cell cycle checkpoint protein. The encoded protein binds to translation and initiation factors and functions as a regulator of mitotic translation. In response to DNA damage this protein plays a role in preventing DNA errors during mitosis. [provided by RefSeq, Aug 2017]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.