Human VASP ORF/cDNA clone-Lentivirus plasmid (NM_003370)
Cat. No.: pGMLP002217
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human VASP/ Lentiviral expression plasmid for VASP lentivirus packaging, VASP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
VASP/ products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP002217 |
Gene Name | VASP |
Accession Number | NM_003370 |
Gene ID | 7408 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1143 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGAGCGAGACGGTCATCTGTTCCAGCCGGGCCACTGTGATGCTTTATGATGATGGCAACAAGCGATGGCTCCCTGCTGGCACGGGTCCCCAGGCCTTCAGCCGCGTCCAGATCTACCACAACCCCACGGCCAATTCCTTTCGCGTCGTGGGCCGGAAGATGCAGCCCGACCAGCAGGTGGTCATCAACTGTGCCATCGTCCGGGGTGTCAAGTATAACCAGGCCACCCCCAACTTCCATCAGTGGCGCGACGCTCGCCAGGTCTGGGGCCTCAACTTCGGCAGCAAGGAGGATGCGGCCCAGTTTGCCGCCGGCATGGCCAGTGCCCTAGAGGCGTTGGAAGGAGGTGGGCCCCCTCCACCCCCAGCACTTCCCACCTGGTCGGTCCCGAACGGCCCCTCCCCGGAGGAGGTGGAGCAGCAGAAAAGGCAGCAGCCCGGCCCGTCGGAGCACATAGAGCGCCGGGTCTCCAATGCAGGAGGCCCACCTGCTCCCCCCGCTGGGGGTCCACCCCCACCACCAGGACCTCCCCCTCCTCCAGGTCCCCCCCCACCCCCAGGTTTGCCCCCTTCGGGGGTCCCAGCTGCAGCGCACGGAGCAGGGGGAGGACCACCCCCTGCACCCCCTCTCCCGGCAGCACAGGGCCCTGGTGGTGGGGGAGCTGGGGCCCCAGGCCTGGCCGCAGCTATTGCTGGAGCCAAACTCAGGAAAGTCAGCAAGCAGGAGGAGGCCTCAGGGGGGCCCACAGCCCCCAAAGCTGAGAGTGGTCGAAGCGGAGGTGGGGGACTCATGGAAGAGATGAACGCCATGCTGGCCCGGAGAAGGAAAGCCACGCAAGTTGGGGAGAAAACCCCCAAGGATGAATCTGCCAATCAGGAGGAGCCAGAGGCCAGAGTCCCGGCCCAGAGTGAATCTGTGCGGAGACCCTGGGAGAAGAACAGCACAACCTTGCCAAGGATGAAGTCGTCTTCTTCGGTGACCACTTCCGAGACCCAACCCTGCACGCCCAGCTCCAGTGATTACTCGGACCTACAGAGGGTGAAACAGGAGCTTCTGGAAGAGGTGAAGAAGGAATTGCAGAAAGTGAAAGAGGAAATCATTGAAGCCTTCGTCCAGGAGCTGAGGAAGCGGGGTTCTCCCTGA |
ORF Protein Sequence | MSETVICSSRATVMLYDDGNKRWLPAGTGPQAFSRVQIYHNPTANSFRVVGRKMQPDQQVVINCAIVRGVKYNQATPNFHQWRDARQVWGLNFGSKEDAAQFAAGMASALEALEGGGPPPPPALPTWSVPNGPSPEEVEQQKRQQPGPSEHIERRVSNAGGPPAPPAGGPPPPPGPPPPPGPPPPPGLPPSGVPAAAHGAGGGPPPAPPLPAAQGPGGGGAGAPGLAAAIAGAKLRKVSKQEEASGGPTAPKAESGRSGGGGLMEEMNAMLARRRKATQVGEKTPKDESANQEEPEARVPAQSESVRRPWEKNSTTLPRMKSSSSVTTSETQPCTPSSSDYSDLQRVKQELLEEVKKELQKVKEEIIEAFVQELRKRGSP |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP2379-Ab | Anti-VASP monoclonal antibody |
Target Antigen | GM-Tg-g-MP2379-Ag | VASP VLP (virus-like particle) |
ORF Viral Vector | pGMLP002217 | Human VASP Lentivirus plasmid |
ORF Viral Vector | vGMLP002217 | Human VASP Lentivirus particle |
Target information
Target ID | GM-MP2379 |
Target Name | VASP |
Gene ID | 7408, 22323, 716022, 361517, 101094805, 403936, 514902, 100070851 |
Gene Symbol and Synonyms | VASP |
Uniprot Accession | P50552 |
Uniprot Entry Name | VASP_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000125753 |
Target Classification | Not Available |
Vasodilator-stimulated phosphoprotein (VASP) is a member of the Ena-VASP protein family. Ena-VASP family members contain an EHV1 N-terminal domain that binds proteins containing E/DFPPPPXD/E motifs and targets Ena-VASP proteins to focal adhesions. In the mid-region of the protein, family members have a proline-rich domain that binds SH3 and WW domain-containing proteins. Their C-terminal EVH2 domain mediates tetramerization and binds both G and F actin. VASP is associated with filamentous actin formation and likely plays a widespread role in cell adhesion and motility. VASP may also be involved in the intracellular signaling pathways that regulate integrin-extracellular matrix interactions. VASP is regulated by the cyclic nucleotide-dependent kinases PKA and PKG. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.