Human VASP ORF/cDNA clone-Lentivirus particle (NM_003370)

Cat. No.: vGMLP002217

Pre-made Human VASP/ Lentiviral expression plasmid for VASP lentivirus packaging, VASP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to VASP/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002217 Human VASP Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002217
Gene Name VASP
Accession Number NM_003370
Gene ID 7408
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1143 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGCGAGACGGTCATCTGTTCCAGCCGGGCCACTGTGATGCTTTATGATGATGGCAACAAGCGATGGCTCCCTGCTGGCACGGGTCCCCAGGCCTTCAGCCGCGTCCAGATCTACCACAACCCCACGGCCAATTCCTTTCGCGTCGTGGGCCGGAAGATGCAGCCCGACCAGCAGGTGGTCATCAACTGTGCCATCGTCCGGGGTGTCAAGTATAACCAGGCCACCCCCAACTTCCATCAGTGGCGCGACGCTCGCCAGGTCTGGGGCCTCAACTTCGGCAGCAAGGAGGATGCGGCCCAGTTTGCCGCCGGCATGGCCAGTGCCCTAGAGGCGTTGGAAGGAGGTGGGCCCCCTCCACCCCCAGCACTTCCCACCTGGTCGGTCCCGAACGGCCCCTCCCCGGAGGAGGTGGAGCAGCAGAAAAGGCAGCAGCCCGGCCCGTCGGAGCACATAGAGCGCCGGGTCTCCAATGCAGGAGGCCCACCTGCTCCCCCCGCTGGGGGTCCACCCCCACCACCAGGACCTCCCCCTCCTCCAGGTCCCCCCCCACCCCCAGGTTTGCCCCCTTCGGGGGTCCCAGCTGCAGCGCACGGAGCAGGGGGAGGACCACCCCCTGCACCCCCTCTCCCGGCAGCACAGGGCCCTGGTGGTGGGGGAGCTGGGGCCCCAGGCCTGGCCGCAGCTATTGCTGGAGCCAAACTCAGGAAAGTCAGCAAGCAGGAGGAGGCCTCAGGGGGGCCCACAGCCCCCAAAGCTGAGAGTGGTCGAAGCGGAGGTGGGGGACTCATGGAAGAGATGAACGCCATGCTGGCCCGGAGAAGGAAAGCCACGCAAGTTGGGGAGAAAACCCCCAAGGATGAATCTGCCAATCAGGAGGAGCCAGAGGCCAGAGTCCCGGCCCAGAGTGAATCTGTGCGGAGACCCTGGGAGAAGAACAGCACAACCTTGCCAAGGATGAAGTCGTCTTCTTCGGTGACCACTTCCGAGACCCAACCCTGCACGCCCAGCTCCAGTGATTACTCGGACCTACAGAGGGTGAAACAGGAGCTTCTGGAAGAGGTGAAGAAGGAATTGCAGAAAGTGAAAGAGGAAATCATTGAAGCCTTCGTCCAGGAGCTGAGGAAGCGGGGTTCTCCCTGA
ORF Protein Sequence MSETVICSSRATVMLYDDGNKRWLPAGTGPQAFSRVQIYHNPTANSFRVVGRKMQPDQQVVINCAIVRGVKYNQATPNFHQWRDARQVWGLNFGSKEDAAQFAAGMASALEALEGGGPPPPPALPTWSVPNGPSPEEVEQQKRQQPGPSEHIERRVSNAGGPPAPPAGGPPPPPGPPPPPGPPPPPGLPPSGVPAAAHGAGGGPPPAPPLPAAQGPGGGGAGAPGLAAAIAGAKLRKVSKQEEASGGPTAPKAESGRSGGGGLMEEMNAMLARRRKATQVGEKTPKDESANQEEPEARVPAQSESVRRPWEKNSTTLPRMKSSSSVTTSETQPCTPSSSDYSDLQRVKQELLEEVKKELQKVKEEIIEAFVQELRKRGSP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2379-Ab Anti-VASP monoclonal antibody
    Target Antigen GM-Tg-g-MP2379-Ag VASP VLP (virus-like particle)
    ORF Viral Vector pGMLP002217 Human VASP Lentivirus plasmid
    ORF Viral Vector vGMLP002217 Human VASP Lentivirus particle


    Target information

    Target ID GM-MP2379
    Target Name VASP
    Gene ID 7408, 22323, 716022, 361517, 101094805, 403936, 514902, 100070851
    Gene Symbol and Synonyms VASP
    Uniprot Accession P50552
    Uniprot Entry Name VASP_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000125753
    Target Classification Not Available

    Vasodilator-stimulated phosphoprotein (VASP) is a member of the Ena-VASP protein family. Ena-VASP family members contain an EHV1 N-terminal domain that binds proteins containing E/DFPPPPXD/E motifs and targets Ena-VASP proteins to focal adhesions. In the mid-region of the protein, family members have a proline-rich domain that binds SH3 and WW domain-containing proteins. Their C-terminal EVH2 domain mediates tetramerization and binds both G and F actin. VASP is associated with filamentous actin formation and likely plays a widespread role in cell adhesion and motility. VASP may also be involved in the intracellular signaling pathways that regulate integrin-extracellular matrix interactions. VASP is regulated by the cyclic nucleotide-dependent kinases PKA and PKG. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.