Human GCG/GLP-1/ GLP1 ORF/cDNA clone-Lentivirus plasmid (NM_002054.4)

Pre-made Human GCG/GLP-1/ GLP1 Lentiviral expression plasmid for GCG lentivirus packaging, GCG lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to GCG/GLP-1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002234 Human GCG Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002234
Gene Name GCG
Accession Number NM_002054.4
Gene ID 2641
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 543 bp
Gene Alias GLP-1, GLP1, GLP2, GRPP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAAAGCATTTACTTTGTGGCTGGATTATTTGTAATGCTGGTACAAGGCAGCTGGCAACGTTCCCTTCAAGACACAGAGGAGAAATCCAGATCATTCTCAGCTTCCCAGGCAGACCCACTCAGTGATCCTGATCAGATGAACGAGGACAAGCGCCATTCACAGGGCACATTCACCAGTGACTACAGCAAGTATCTGGACTCCAGGCGTGCCCAAGATTTTGTGCAGTGGTTGATGAATACCAAGAGGAACAGGAATAACATTGCCAAACGTCACGATGAATTTGAGAGACATGCTGAAGGGACCTTTACCAGTGATGTAAGTTCTTATTTGGAAGGCCAAGCTGCCAAGGAATTCATTGCTTGGCTGGTGAAAGGCCGAGGAAGGCGAGATTTCCCAGAAGAGGTCGCCATTGTTGAAGAACTTGGCCGCAGACATGCTGATGGTTCTTTCTCTGATGAGATGAACACCATTCTTGATAATCTTGCCGCCAGGGACTTTATAAACTGGTTGATTCAGACCAAAATCACTGACAGGAAATAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T44919-Ab Anti-GLUC/ GCG/ GLP-1 functional antibody
    Target Antigen GM-Tg-g-T44919-Ag GCG protein
    ORF Viral Vector pGMLP002234 Human GCG Lentivirus plasmid
    ORF Viral Vector vGMLP002234 Human GCG Lentivirus particle


    Target information

    Target ID GM-T44919
    Target Name GCG
    Gene ID 2641, 14526, 705508, 24952, 101097825, 403571, 280802, 100051551
    Gene Symbol and Synonyms GCG,GLP-1,GLP-2,GLP1,GLP2,Glu,GRPP,PPG
    Uniprot Accession P01275
    Uniprot Entry Name GLUC_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000115263
    Target Classification Not Available

    The protein encoded by this gene is actually a preproprotein that is cleaved into four distinct mature peptides. One of these, glucagon, is a pancreatic hormone that counteracts the glucose-lowering action of insulin by stimulating glycogenolysis and gluconeogenesis. Glucagon is a ligand for a specific G-protein linked receptor whose signalling pathway controls cell proliferation. Two of the other peptides are secreted from gut endocrine cells and promote nutrient absorption through distinct mechanisms. Finally, the fourth peptide is similar to glicentin, an active enteroglucagon. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.