Human GCG/GLP-1/ GLP1 ORF/cDNA clone-Lentivirus particle (NM_002054.4)
Pre-made Human GCG/GLP-1/ GLP1 Lentiviral expression plasmid for GCG lentivirus packaging, GCG lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to GCG/GLP-1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP002234 | Human GCG Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP002234 |
Gene Name | GCG |
Accession Number | NM_002054.4 |
Gene ID | 2641 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 543 bp |
Gene Alias | GLP-1, GLP1, GLP2, GRPP |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAAAAGCATTTACTTTGTGGCTGGATTATTTGTAATGCTGGTACAAGGCAGCTGGCAACGTTCCCTTCAAGACACAGAGGAGAAATCCAGATCATTCTCAGCTTCCCAGGCAGACCCACTCAGTGATCCTGATCAGATGAACGAGGACAAGCGCCATTCACAGGGCACATTCACCAGTGACTACAGCAAGTATCTGGACTCCAGGCGTGCCCAAGATTTTGTGCAGTGGTTGATGAATACCAAGAGGAACAGGAATAACATTGCCAAACGTCACGATGAATTTGAGAGACATGCTGAAGGGACCTTTACCAGTGATGTAAGTTCTTATTTGGAAGGCCAAGCTGCCAAGGAATTCATTGCTTGGCTGGTGAAAGGCCGAGGAAGGCGAGATTTCCCAGAAGAGGTCGCCATTGTTGAAGAACTTGGCCGCAGACATGCTGATGGTTCTTTCTCTGATGAGATGAACACCATTCTTGATAATCTTGCCGCCAGGGACTTTATAAACTGGTTGATTCAGACCAAAATCACTGACAGGAAATAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T44919-Ab | Anti-GLUC/ GCG/ GLP-1 functional antibody |
Target Antigen | GM-Tg-g-T44919-Ag | GCG protein |
ORF Viral Vector | pGMLP002234 | Human GCG Lentivirus plasmid |
ORF Viral Vector | vGMLP002234 | Human GCG Lentivirus particle |
Target information
Target ID | GM-T44919 |
Target Name | GCG |
Gene ID | 2641, 14526, 705508, 24952, 101097825, 403571, 280802, 100051551 |
Gene Symbol and Synonyms | GCG,GLP-1,GLP-2,GLP1,GLP2,Glu,GRPP,PPG |
Uniprot Accession | P01275 |
Uniprot Entry Name | GLUC_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000115263 |
Target Classification | Not Available |
The protein encoded by this gene is actually a preproprotein that is cleaved into four distinct mature peptides. One of these, glucagon, is a pancreatic hormone that counteracts the glucose-lowering action of insulin by stimulating glycogenolysis and gluconeogenesis. Glucagon is a ligand for a specific G-protein linked receptor whose signalling pathway controls cell proliferation. Two of the other peptides are secreted from gut endocrine cells and promote nutrient absorption through distinct mechanisms. Finally, the fourth peptide is similar to glicentin, an active enteroglucagon. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.