Human WNT3/INT4/ TETAMS ORF/cDNA clone-Lentivirus plasmid (NM_030753.4)
Pre-made Human WNT3/INT4/ TETAMS Lentiviral expression plasmid for WNT3 lentivirus packaging, WNT3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to WNT3/INT4 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP002254 | Human WNT3 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP002254 |
Gene Name | WNT3 |
Accession Number | NM_030753.4 |
Gene ID | 7473 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1068 bp |
Gene Alias | INT4, TETAMS |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGAGCCCCACCTGCTCGGGCTGCTCCTCGGCCTCCTGCTCGGTGGCACCAGGGTCCTCGCTGGCTACCCAATTTGGTGGTCCCTGGCCCTGGGCCAGCAGTACACATCTCTGGGCTCACAGCCCCTGCTCTGCGGCTCCATCCCAGGCCTGGTCCCCAAGCAACTGCGCTTCTGCCGCAATTACATCGAGATCATGCCCAGCGTGGCCGAGGGCGTGAAGCTGGGCATCCAGGAGTGCCAGCACCAGTTCCGGGGCCGCCGCTGGAACTGCACCACCATAGATGACAGCCTGGCCATCTTTGGGCCCGTCCTCGACAAAGCCACCCGCGAGTCGGCCTTCGTTCACGCCATCGCCTCGGCCGGCGTGGCCTTCGCCGTCACCCGCTCCTGCGCCGAGGGCACCTCCACCATTTGCGGCTGTGACTCGCATCATAAGGGGCCGCCTGGCGAAGGCTGGAAGTGGGGCGGCTGCAGCGAGGACGCTGACTTCGGCGTGTTAGTGTCCAGGGAGTTCGCGGATGCGCGCGAGAACAGGCCGGACGCGCGCTCGGCCATGAACAAGCACAACAACGAGGCGGGCCGCACGACTATCCTGGACCACATGCACCTCAAATGCAAGTGCCACGGGCTGTCGGGCAGCTGTGAGGTGAAGACCTGCTGGTGGGCGCAGCCTGACTTCCGTGCCATCGGTGACTTCCTCAAGGACAAGTATGACAGCGCCTCGGAGATGGTAGTAGAGAAGCACCGTGAGTCCCGAGGCTGGGTGGAGACCCTCCGGGCCAAGTACTCGCTCTTCAAGCCACCCACGGAGAGGGACCTGGTCTACTACGAGAACTCCCCCAACTTTTGTGAGCCCAACCCAGAGACGGGTTCCTTTGGCACAAGGGACCGGACTTGCAATGTCACCTCCCACGGCATCGATGGCTGCGATCTGCTCTGCTGTGGCCGGGGCCACAACACGAGGACGGAGAAGCGGAAGGAAAAATGCCACTGCATCTTCCACTGGTGCTGCTACGTCAGCTGCCAGGAGTGTATTCGCATCTACGACGTGCACACCTGCAAGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP1935-Ab | Anti-WNT3/ INT4/ TETAMS monoclonal antibody |
Target Antigen | GM-Tg-g-MP1935-Ag | WNT3 VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-MP1935 | wingless-related MMTV integration site 3 (WNT3) protein & antibody |
ORF Viral Vector | pGMLP002254 | Human WNT3 Lentivirus plasmid |
ORF Viral Vector | vGMLP002254 | Human WNT3 Lentivirus particle |
Target information
Target ID | GM-MP1935 |
Target Name | WNT3 |
Gene ID | 7473, 22415, 716909, 24882, 101088533, 609107, 540753, 100049880 |
Gene Symbol and Synonyms | Int-4,INT4,TETAMS,Wnt-3,WNT3 |
Uniprot Accession | P56703 |
Uniprot Entry Name | WNT3_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000108379 |
Target Classification | Tumor-associated antigen (TAA) |
The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is a member of the WNT gene family. It encodes a protein which shows 98% amino acid identity to mouse Wnt3 protein, and 84% to human WNT3A protein, another WNT gene product. The mouse studies show the requirement of Wnt3 in primary axis formation in the mouse. Studies of the gene expression suggest that this gene may play a key role in some cases of human breast, rectal, lung, and gastric cancer through activation of the WNT-beta-catenin-TCF signaling pathway. This gene is clustered with WNT15, another family member, in the chromosome 17q21 region. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.