Human GHSR/GHDP ORF/cDNA clone-Lentivirus plasmid (NM_198407)
Pre-made Human GHSR/GHDP Lentiviral expression plasmid for GHSR lentivirus packaging, GHSR lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to GHSR/GHDP products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP002289 | Human GHSR Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP002289 |
Gene Name | GHSR |
Accession Number | NM_198407 |
Gene ID | 2693 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1101 bp |
Gene Alias | GHDP |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTGGAACGCGACGCCCAGCGAAGAGCCGGGGTTCAACCTCACACTGGCCGACCTGGACTGGGATGCTTCCCCCGGCAACGACTCGCTGGGCGACGAGCTGCTGCAGCTCTTCCCCGCGCCGCTGCTGGCGGGCGTCACAGCCACCTGCGTGGCACTCTTCGTGGTGGGCATCGCTGGCAACCTGCTCACCATGCTGGTGGTGTCGCGCTTCCGCGAGCTGCGCACCACCACCAACCTCTACCTGTCCAGCATGGCCTTCTCCGATCTGCTCATCTTCCTCTGCATGCCCCTGGACCTCGTTCGCCTCTGGCAGTACCGGCCCTGGAACTTCGGCGACCTCCTCTGCAAACTCTTCCAATTCGTCAGTGAGAGCTGCACCTACGCCACGGTGCTCACCATCACAGCGCTGAGCGTCGAGCGCTACTTCGCCATCTGCTTCCCACTCCGGGCCAAGGTGGTGGTCACCAAGGGGCGGGTGAAGCTGGTCATCTTCGTCATCTGGGCCGTGGCCTTCTGCAGCGCCGGGCCCATCTTCGTGCTAGTCGGGGTGGAGCACGAGAACGGCACCGACCCTTGGGACACCAACGAGTGCCGCCCCACCGAGTTTGCGGTGCGCTCTGGACTGCTCACGGTCATGGTGTGGGTGTCCAGCATCTTCTTCTTCCTTCCTGTCTTCTGTCTCACGGTCCTCTACAGTCTCATCGGCAGGAAGCTGTGGCGGAGGAGGCGCGGCGATGCTGTCGTGGGTGCCTCGCTCAGGGACCAGAACCACAAGCAAACCGTGAAAATGCTGGCTGTAGTGGTGTTTGCCTTCATCCTCTGCTGGCTCCCCTTCCACGTAGGGCGATATTTATTTTCCAAATCCTTTGAGCCTGGCTCCTTGGAGATTGCTCAGATCAGCCAGTACTGCAACCTCGTGTCCTTTGTCCTCTTCTACCTCAGTGCTGCCATCAACCCCATTCTGTACAACATCATGTCCAAGAAGTACCGGGTGGCAGTGTTCAGACTTCTGGGATTCGAACCCTTCTCCCAGAGAAAGCTCTCCACTCTGAAAGATGAAAGTTCTCGGGCCTGGACAGAATCTAGTATTAATACATGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T59604-Ab | Anti-GHSR/ GHDP monoclonal antibody |
Target Antigen | GM-Tg-g-T59604-Ag | GHSR VLP (virus-like particle) |
ORF Viral Vector | pGMLP002289 | Human GHSR Lentivirus plasmid |
ORF Viral Vector | vGMLP002289 | Human GHSR Lentivirus particle |
Target information
Target ID | GM-T59604 |
Target Name | GHSR |
Gene ID | 2693, 208188, 694587, 84022, 101083540, 100101479, 514203, 100057865 |
Gene Symbol and Synonyms | C530020I22Rik,GHDP,GHRP,GHS-R,GHSR,Ghsr1a |
Uniprot Accession | Q92847 |
Uniprot Entry Name | GHSR_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000121853 |
Target Classification | GPCR |
This gene encodes a member of the G-protein coupled receptor family. The encoded protein may play a role in energy homeostasis and regulation of body weight. Two identified transcript variants are expressed in several tissues and are evolutionary conserved in fish and swine. One transcript, 1a, excises an intron and encodes the functional protein; this protein is the receptor for the Ghrelin ligand and defines a neuroendocrine pathway for growth hormone release. The second transcript (1b) retains the intron and does not function as a receptor for Ghrelin; however, it may function to attenuate activity of isoform 1a. Mutations in this gene are associated with autosomal idiopathic short stature.[provided by RefSeq, Apr 2010]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.