Human GHSR/GHDP ORF/cDNA clone-Lentivirus particle (NM_198407)

Pre-made Human GHSR/GHDP Lentiviral expression plasmid for GHSR lentivirus packaging, GHSR lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to GHSR/GHDP products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002289 Human GHSR Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002289
Gene Name GHSR
Accession Number NM_198407
Gene ID 2693
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1101 bp
Gene Alias GHDP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTGGAACGCGACGCCCAGCGAAGAGCCGGGGTTCAACCTCACACTGGCCGACCTGGACTGGGATGCTTCCCCCGGCAACGACTCGCTGGGCGACGAGCTGCTGCAGCTCTTCCCCGCGCCGCTGCTGGCGGGCGTCACAGCCACCTGCGTGGCACTCTTCGTGGTGGGCATCGCTGGCAACCTGCTCACCATGCTGGTGGTGTCGCGCTTCCGCGAGCTGCGCACCACCACCAACCTCTACCTGTCCAGCATGGCCTTCTCCGATCTGCTCATCTTCCTCTGCATGCCCCTGGACCTCGTTCGCCTCTGGCAGTACCGGCCCTGGAACTTCGGCGACCTCCTCTGCAAACTCTTCCAATTCGTCAGTGAGAGCTGCACCTACGCCACGGTGCTCACCATCACAGCGCTGAGCGTCGAGCGCTACTTCGCCATCTGCTTCCCACTCCGGGCCAAGGTGGTGGTCACCAAGGGGCGGGTGAAGCTGGTCATCTTCGTCATCTGGGCCGTGGCCTTCTGCAGCGCCGGGCCCATCTTCGTGCTAGTCGGGGTGGAGCACGAGAACGGCACCGACCCTTGGGACACCAACGAGTGCCGCCCCACCGAGTTTGCGGTGCGCTCTGGACTGCTCACGGTCATGGTGTGGGTGTCCAGCATCTTCTTCTTCCTTCCTGTCTTCTGTCTCACGGTCCTCTACAGTCTCATCGGCAGGAAGCTGTGGCGGAGGAGGCGCGGCGATGCTGTCGTGGGTGCCTCGCTCAGGGACCAGAACCACAAGCAAACCGTGAAAATGCTGGCTGTAGTGGTGTTTGCCTTCATCCTCTGCTGGCTCCCCTTCCACGTAGGGCGATATTTATTTTCCAAATCCTTTGAGCCTGGCTCCTTGGAGATTGCTCAGATCAGCCAGTACTGCAACCTCGTGTCCTTTGTCCTCTTCTACCTCAGTGCTGCCATCAACCCCATTCTGTACAACATCATGTCCAAGAAGTACCGGGTGGCAGTGTTCAGACTTCTGGGATTCGAACCCTTCTCCCAGAGAAAGCTCTCCACTCTGAAAGATGAAAGTTCTCGGGCCTGGACAGAATCTAGTATTAATACATGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T59604-Ab Anti-GHSR/ GHDP monoclonal antibody
    Target Antigen GM-Tg-g-T59604-Ag GHSR VLP (virus-like particle)
    ORF Viral Vector pGMLP002289 Human GHSR Lentivirus plasmid
    ORF Viral Vector vGMLP002289 Human GHSR Lentivirus particle


    Target information

    Target ID GM-T59604
    Target Name GHSR
    Gene ID 2693, 208188, 694587, 84022, 101083540, 100101479, 514203, 100057865
    Gene Symbol and Synonyms C530020I22Rik,GHDP,GHRP,GHS-R,GHSR,Ghsr1a
    Uniprot Accession Q92847
    Uniprot Entry Name GHSR_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000121853
    Target Classification GPCR

    This gene encodes a member of the G-protein coupled receptor family. The encoded protein may play a role in energy homeostasis and regulation of body weight. Two identified transcript variants are expressed in several tissues and are evolutionary conserved in fish and swine. One transcript, 1a, excises an intron and encodes the functional protein; this protein is the receptor for the Ghrelin ligand and defines a neuroendocrine pathway for growth hormone release. The second transcript (1b) retains the intron and does not function as a receptor for Ghrelin; however, it may function to attenuate activity of isoform 1a. Mutations in this gene are associated with autosomal idiopathic short stature.[provided by RefSeq, Apr 2010]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.