Human CA4/CAIV/ Car4 ORF/cDNA clone-Lentivirus plasmid (NM_000717)

Pre-made Human CA4/CAIV/ Car4 Lentiviral expression plasmid for CA4 lentivirus packaging, CA4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to CA-IV/CA4/CAIV products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002307 Human CA4 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002307
Gene Name CA4
Accession Number NM_000717
Gene ID 762
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 939 bp
Gene Alias CAIV, Car4, RP17
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCGGATGCTGCTGGCGCTCCTGGCCCTCTCCGCGGCGCGGCCATCGGCCAGTGCAGAGTCACACTGGTGCTACGAGGTTCAAGCCGAGTCCTCCAACTACCCCTGCTTGGTGCCAGTCAAGTGGGGTGGAAACTGCCAGAAGGACCGCCAGTCCCCCATCAACATCGTCACCACCAAGGCAAAGGTGGACAAAAAACTGGGACGCTTCTTCTTCTCTGGCTACGATAAGAAGCAAACGTGGACTGTCCAAAATAACGGGCACTCAGTGATGATGTTGCTGGAGAACAAGGCCAGCATTTCTGGAGGAGGACTGCCTGCCCCATACCAGGCCAAACAGTTGCACCTGCACTGGTCCGACTTGCCATATAAGGGCTCGGAGCACAGCCTCGATGGGGAGCACTTTGCCATGGAGATGCACATAGTACATGAGAAAGAGAAGGGGACATCGAGGAATGTGAAAGAGGCCCAGGACCCTGAAGACGAAATTGCGGTGCTGGCCTTTCTGGTGGAGGCTGGAACCCAGGTGAACGAGGGCTTCCAGCCACTGGTGGAGGCACTGTCTAATATCCCCAAACCTGAGATGAGCACTACGATGGCAGAGAGCAGCCTGTTGGACCTGCTCCCCAAGGAGGAGAAACTGAGGCACTACTTCCGCTACCTGGGCTCACTCACCACACCGACCTGCGATGAGAAGGTCGTCTGGACTGTGTTCCGGGAGCCCATTCAGCTTCACAGAGAACAGATCCTGGCATTCTCTCAGAAGCTGTACTACGACAAGGAACAGACAGTGAGCATGAAGGACAATGTCAGGCCCCTGCAGCAGCTGGGGCAGCGCACGGTGATAAAGTCCGGGGCCCCGGGTCGGCCGCTGCCCTGGGCCCTGCCTGCCCTGCTGGGCCCCATGCTGGCCTGCCTGCTGGCCGGCTTCCTGCGATGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T53378-Ab Anti-CAH4/ CA-IV/ CA4 monoclonal antibody
    Target Antigen GM-Tg-g-T53378-Ag CA-IV/CA4 VLP (virus-like particle)
    ORF Viral Vector pGMLP002307 Human CA4 Lentivirus plasmid
    ORF Viral Vector vGMLP002307 Human CA4 Lentivirus particle


    Target information

    Target ID GM-T53378
    Target Name CA-IV
    Gene ID 762, 12351, 716919, 29242, 101088531, 480591, 280741, 100071384
    Gene Symbol and Synonyms CA4,CAIV,Car4,RP17
    Uniprot Accession P22748
    Uniprot Entry Name CAH4_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000167434
    Target Classification Not Available

    Carbonic anhydrases (CAs) are a large family of zinc metalloenzymes that catalyze the reversible hydration of carbon dioxide. They participate in a variety of biological processes, including respiration, calcification, acid-base balance, bone resorption, and the formation of aqueous humor, cerebrospinal fluid, saliva, and gastric acid. They show extensive diversity in tissue distribution and in their subcellular localization. This gene encodes a glycosylphosphatidyl-inositol-anchored membrane isozyme expressed on the luminal surfaces of pulmonary (and certain other) capillaries and proximal renal tubules. Its exact function is not known; however, it may have a role in inherited renal abnormalities of bicarbonate transport. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.