Human NECTIN4/EDSS1/ LNIR ORF/cDNA clone-Lentivirus plasmid (NM_030916)
Pre-made Human NECTIN4/EDSS1/ LNIR Lentiviral expression plasmid for NECTIN4 lentivirus packaging, NECTIN4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to NECTIN4/EDSS1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP002312 | Human NECTIN4 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP002312 |
Gene Name | NECTIN4 |
Accession Number | NM_030916 |
Gene ID | 81607 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1533 bp |
Gene Alias | EDSS1, LNIR, nectin-4, PRR4, PVRL4 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCCCCTGTCCCTGGGAGCCGAGATGTGGGGGCCTGAGGCCTGGCTGCTGCTGCTGCTACTGCTGGCATCATTTACAGGCCGGTGCCCCGCGGGTGAGCTGGAGACCTCAGACGTGGTAACTGTGGTGCTGGGCCAGGACGCAAAACTGCCCTGCTTCTACCGAGGGGACTCCGGCGAGCAAGTGGGGCAAGTGGCATGGGCTCGGGTGGACGCGGGCGAAGGCGCCCAGGAACTAGCGCTACTGCACTCCAAATACGGGCTTCATGTGAGCCCGGCTTACGAGGGCCGCGTGGAGCAGCCGCCGCCCCCACGCAACCCCCTGGACGGCTCAGTGCTCCTGCGCAACGCAGTGCAGGCGGATGAGGGCGAGTACGAGTGCCGGGTCAGCACCTTCCCCGCCGGCAGCTTCCAGGCGCGGCTGCGGCTCCGAGTGCTGGTGCCTCCCCTGCCCTCACTGAATCCTGGTCCAGCACTAGAAGAGGGCCAGGGCCTGACCCTGGCAGCCTCCTGCACAGCTGAGGGCAGCCCAGCCCCCAGCGTGACCTGGGACACGGAGGTCAAAGGCACAACGTCCAGCCGTTCCTTCAAGCACTCCCGCTCTGCTGCCGTCACCTCAGAGTTCCACTTGGTGCCTAGCCGCAGCATGAATGGGCAGCCACTGACTTGTGTGGTGTCCCATCCTGGCCTGCTCCAGGACCAAAGGATCACCCACATCCTCCACGTGTCCTTCCTTGCTGAGGCCTCTGTGAGGGGCCTTGAAGACCAAAATCTGTGGCACATTGGCAGAGAAGGAGCTATGCTCAAGTGCCTGAGTGAAGGGCAGCCCCCTCCCTCATACAACTGGACACGGCTGGATGGGCCTCTGCCCAGTGGGGTACGAGTGGATGGGGACACTTTGGGCTTTCCCCCACTGACCACTGAGCACAGCGGCATCTACGTCTGCCATGTCAGCAATGAGTTCTCCTCAAGGGATTCTCAGGTCACTGTGGATGTTCTTGACCCCCAGGAAGACTCTGGGAAGCAGGTGGACCTAGTGTCAGCCTCGGTGGTGGTGGTGGGTGTGATCGCCGCACTCTTGTTCTGCCTTCTGGTGGTGGTGGTGGTGCTCATGTCCCGATACCATCGGCGCAAGGCCCAGCAGATGACCCAGAAATATGAGGAGGAGCTGACCCTGACCAGGGAGAACTCCATCCGGAGGCTGCATTCCCATCACACGGACCCCAGGAGCCAGCCGGAGGAGAGTGTAGGGCTGAGAGCCGAGGGCCACCCTGATAGTCTCAAGGACAACAGTAGCTGCTCTGTGATGAGTGAAGAGCCCGAGGGCCGCAGTTACTCCACGCTGACCACGGTGAGGGAGATAGAAACACAGACTGAACTGCTGTCTCCAGGCTCTGGGCGGGCCGAGGAGGAGGAAGATCAGGATGAAGGCATCAAACAGGCCATGAACCATTTTGTTCAGGAGAATGGGACCCTACGGGCCAAGCCCACGGGCAATGGCATCTACATCAATGGGCGGGGACACCTGGTCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-INN-833 | Pre-Made Enfortumab Vedotin Biosimilar, Whole Mab Adc, Anti-PVRL4/NECTIN4 Antibody: Anti-EDSS1/LNIR/PRR4/nectin-4 therapeutic antibody Drug Conjugate |
Biosimilar | GMP-Bios-ab-182 | Pre-Made Enfortumab biosimilar, Whole mAb ADC, Anti-PVRL4/NECTIN4 Antibody: Anti-EDSS1/LNIR/PRR4/nectin-4 therapeutic antibody |
Target Antibody | GM-Tg-g-T35591-Ab | Anti-NECT4/ NECTIN4/ EDSS1 monoclonal antibody |
Target Antigen | GM-Tg-g-T35591-Ag | NECTIN4 VLP (virus-like particle) |
ORF Viral Vector | pGMLP002312 | Human NECTIN4 Lentivirus plasmid |
ORF Viral Vector | vGMLP002312 | Human NECTIN4 Lentivirus particle |
Target information
Target ID | GM-T35591 |
Target Name | NECTIN4 |
Gene ID | 81607, 71740, 719843, 498281, 101092485, 609931, 507718, 100066309 |
Gene Symbol and Synonyms | 1200017F15Rik,EDSS1,LNIR,nectin-4,NECTIN4,PRR4,PVRL4,RGD1559826 |
Uniprot Accession | Q96NY8 |
Uniprot Entry Name | NECT4_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Immuno-oncology Target, INN Index |
Disease | Breast Cancer, Mucocutaneous lymph node syndrome [Kawasaki] |
Gene Ensembl | ENSG00000143217 |
Target Classification | Checkpoint-Immuno Oncology |
This gene encodes a member of the nectin family. The encoded protein contains two immunoglobulin-like (Ig-like) C2-type domains and one Ig-like V-type domain. It is involved in cell adhesion through trans-homophilic and -heterophilic interactions. It is a single-pass type I membrane protein. The soluble form is produced by proteolytic cleavage at the cell surface by the metalloproteinase ADAM17/TACE. The secreted form is found in both breast tumor cell lines and breast tumor patients. Mutations in this gene are the cause of ectodermal dysplasia-syndactyly syndrome type 1, an autosomal recessive disorder. Alternatively spliced transcript variants have been found but the full-length nature of the variant has not been determined.[provided by RefSeq, Jan 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.