Human NECTIN4/EDSS1/LNIR ORF/cDNA clone-Lentivirus plasmid (NM_030916)

Cat. No.: pGMLP002312
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human NECTIN4/EDSS1/LNIR Lentiviral expression plasmid for NECTIN4 lentivirus packaging, NECTIN4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to NECTIN4/EDSS1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $775.23
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002312
Gene Name NECTIN4
Accession Number NM_030916
Gene ID 81607
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1533 bp
Gene Alias EDSS1,LNIR,nectin-4,PRR4,PVRL4
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCCCCTGTCCCTGGGAGCCGAGATGTGGGGGCCTGAGGCCTGGCTGCTGCTGCTGCTACTGCTGGCATCATTTACAGGCCGGTGCCCCGCGGGTGAGCTGGAGACCTCAGACGTGGTAACTGTGGTGCTGGGCCAGGACGCAAAACTGCCCTGCTTCTACCGAGGGGACTCCGGCGAGCAAGTGGGGCAAGTGGCATGGGCTCGGGTGGACGCGGGCGAAGGCGCCCAGGAACTAGCGCTACTGCACTCCAAATACGGGCTTCATGTGAGCCCGGCTTACGAGGGCCGCGTGGAGCAGCCGCCGCCCCCACGCAACCCCCTGGACGGCTCAGTGCTCCTGCGCAACGCAGTGCAGGCGGATGAGGGCGAGTACGAGTGCCGGGTCAGCACCTTCCCCGCCGGCAGCTTCCAGGCGCGGCTGCGGCTCCGAGTGCTGGTGCCTCCCCTGCCCTCACTGAATCCTGGTCCAGCACTAGAAGAGGGCCAGGGCCTGACCCTGGCAGCCTCCTGCACAGCTGAGGGCAGCCCAGCCCCCAGCGTGACCTGGGACACGGAGGTCAAAGGCACAACGTCCAGCCGTTCCTTCAAGCACTCCCGCTCTGCTGCCGTCACCTCAGAGTTCCACTTGGTGCCTAGCCGCAGCATGAATGGGCAGCCACTGACTTGTGTGGTGTCCCATCCTGGCCTGCTCCAGGACCAAAGGATCACCCACATCCTCCACGTGTCCTTCCTTGCTGAGGCCTCTGTGAGGGGCCTTGAAGACCAAAATCTGTGGCACATTGGCAGAGAAGGAGCTATGCTCAAGTGCCTGAGTGAAGGGCAGCCCCCTCCCTCATACAACTGGACACGGCTGGATGGGCCTCTGCCCAGTGGGGTACGAGTGGATGGGGACACTTTGGGCTTTCCCCCACTGACCACTGAGCACAGCGGCATCTACGTCTGCCATGTCAGCAATGAGTTCTCCTCAAGGGATTCTCAGGTCACTGTGGATGTTCTTGACCCCCAGGAAGACTCTGGGAAGCAGGTGGACCTAGTGTCAGCCTCGGTGGTGGTGGTGGGTGTGATCGCCGCACTCTTGTTCTGCCTTCTGGTGGTGGTGGTGGTGCTCATGTCCCGATACCATCGGCGCAAGGCCCAGCAGATGACCCAGAAATATGAGGAGGAGCTGACCCTGACCAGGGAGAACTCCATCCGGAGGCTGCATTCCCATCACACGGACCCCAGGAGCCAGCCGGAGGAGAGTGTAGGGCTGAGAGCCGAGGGCCACCCTGATAGTCTCAAGGACAACAGTAGCTGCTCTGTGATGAGTGAAGAGCCCGAGGGCCGCAGTTACTCCACGCTGACCACGGTGAGGGAGATAGAAACACAGACTGAACTGCTGTCTCCAGGCTCTGGGCGGGCCGAGGAGGAGGAAGATCAGGATGAAGGCATCAAACAGGCCATGAACCATTTTGTTCAGGAGAATGGGACCCTACGGGCCAAGCCCACGGGCAATGGCATCTACATCAATGGGCGGGGACACCTGGTCTGA
ORF Protein Sequence MPLSLGAEMWGPEAWLLLLLLLASFTGRCPAGELETSDVVTVVLGQDAKLPCFYRGDSGEQVGQVAWARVDAGEGAQELALLHSKYGLHVSPAYEGRVEQPPPPRNPLDGSVLLRNAVQADEGEYECRVSTFPAGSFQARLRLRVLVPPLPSLNPGPALEEGQGLTLAASCTAEGSPAPSVTWDTEVKGTTSSRSFKHSRSAAVTSEFHLVPSRSMNGQPLTCVVSHPGLLQDQRITHILHVSFLAEASVRGLEDQNLWHIGREGAMLKCLSEGQPPPSYNWTRLDGPLPSGVRVDGDTLGFPPLTTEHSGIYVCHVSNEFSSRDSQVTVDVLDPQEDSGKQVDLVSASVVVVGVIAALLFCLLVVVVVLMSRYHRRKAQQMTQKYEEELTLTRENSIRRLHSHHTDPRSQPEESVGLRAEGHPDSLKDNSSCSVMSEEPEGRSYSTLTTVREIETQTELLSPGSGRAEEEEDQDEGIKQAMNHFVQENGTLRAKPTGNGIYINGRGHLV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-833 Pre-Made Enfortumab Vedotin Biosimilar, Whole Mab Adc, Anti-PVRL4/NECTIN4 Antibody: Anti-EDSS1/LNIR/PRR4/nectin-4 therapeutic antibody Drug Conjugate
    Biosimilar GMP-Bios-ab-182 Pre-Made Enfortumab biosimilar, Whole mAb ADC, Anti-PVRL4/NECTIN4 Antibody: Anti-EDSS1/LNIR/PRR4/nectin-4 therapeutic antibody
    Target Antibody GM-Tg-g-T35591-Ab Anti-NECT4/ NECTIN4/ EDSS1 monoclonal antibody
    Target Antigen GM-Tg-g-T35591-Ag NECTIN4 VLP (virus-like particle)
    ORF Viral Vector pGMLP002312 Human NECTIN4 Lentivirus plasmid
    ORF Viral Vector vGMLP002312 Human NECTIN4 Lentivirus particle


    Target information

    Target ID GM-T35591
    Target Name NECTIN4
    Gene ID 81607, 71740, 719843, 498281, 101092485, 609931, 507718, 100066309
    Gene Symbol and Synonyms 1200017F15Rik,EDSS1,LNIR,nectin-4,NECTIN4,PRR4,PVRL4,RGD1559826
    Uniprot Accession Q96NY8
    Uniprot Entry Name NECT4_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease Breast Cancer, Mucocutaneous lymph node syndrome [Kawasaki]
    Gene Ensembl ENSG00000143217
    Target Classification Checkpoint-Immuno Oncology

    This gene encodes a member of the nectin family. The encoded protein contains two immunoglobulin-like (Ig-like) C2-type domains and one Ig-like V-type domain. It is involved in cell adhesion through trans-homophilic and -heterophilic interactions. It is a single-pass type I membrane protein. The soluble form is produced by proteolytic cleavage at the cell surface by the metalloproteinase ADAM17/TACE. The secreted form is found in both breast tumor cell lines and breast tumor patients. Mutations in this gene are the cause of ectodermal dysplasia-syndactyly syndrome type 1, an autosomal recessive disorder. Alternatively spliced transcript variants have been found but the full-length nature of the variant has not been determined.[provided by RefSeq, Jan 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.