Human AK4/AK 4/ AK3 ORF/cDNA clone-Lentivirus plasmid (NM_013410)

Pre-made Human AK4/AK 4/ AK3 Lentiviral expression plasmid for AK4 lentivirus packaging, AK4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to AK4/AK 4 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002502 Human AK4 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002502
Gene Name AK4
Accession Number NM_013410
Gene ID 205
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 672 bp
Gene Alias AK 4, AK3, AK3L1, AK3L2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCTTCCAAACTCCTGCGCGCGGTCATCCTCGGGCCGCCCGGCTCGGGCAAGGGCACCGTGTGCCAGAGGATCGCCCAGAACTTTGGTCTCCAGCATCTCTCCAGCGGCCACTTCTTGCGGGAGAACATCAAGGCCAGCACCGAAGTTGGTGAGATGGCAAAGCAGTATATAGAGAAAAGTCTTTTGGTTCCAGACCATGTGATCACACGCCTAATGATGTCCGAGTTGGAGAACAGGCGTGGCCAGCACTGGCTCCTTGATGGTTTTCCTAGGACATTAGGACAAGCCGAAGCCCTGGACAAAATCTGTGAAGTGGATCTAGTGATCAGTTTGAATATTCCATTTGAAACACTTAAAGATCGTCTCAGCCGCCGTTGGATTCACCCTCCTAGCGGAAGGGTATATAACCTGGACTTCAATCCACCTCATGTACATGGTATTGATGACGTCACTGGTGAACCGTTAGTCCAGCAGGAGGATGATAAACCCGAAGCAGTTGCTGCCAGGCTAAGACAGTACAAAGACGTGGCAAAGCCAGTCATTGAATTATACAAGAGCCGAGGAGTGCTCCACCAATTTTCCGGAACGGAGACGAACAAAATCTGGCCCTACGTTTACACACTTTTCTCAAACAAGATCACACCTATTCAGTCCAAAGAAGCATATTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1556-Ab Anti-KAD4/ AK4/ AK 4 functional antibody
    Target Antigen GM-Tg-g-SE1556-Ag AK4 protein
    ORF Viral Vector pGMLP002502 Human AK4 Lentivirus plasmid
    ORF Viral Vector vGMLP002502 Human AK4 Lentivirus particle


    Target information

    Target ID GM-SE1556
    Target Name AK4
    Gene ID 205, 11639, 698560, 29223, 101084638, 489554, 517063, 100069665
    Gene Symbol and Synonyms AK 4,Ak-3,Ak-4,AK3,AK3L1,AK3L2,AK4,D4Ertd274e
    Uniprot Accession P27144
    Uniprot Entry Name KAD4_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000162433
    Target Classification Not Available

    This gene encodes a member of the adenylate kinase family of enzymes. The encoded protein is localized to the mitochondrial matrix. Adenylate kinases regulate the adenine and guanine nucleotide compositions within a cell by catalyzing the reversible transfer of phosphate group among these nucleotides. Five isozymes of adenylate kinase have been identified in vertebrates. Expression of these isozymes is tissue-specific and developmentally regulated. A pseudogene for this gene has been located on chromosome 17. Three transcript variants encoding the same protein have been identified for this gene. Sequence alignment suggests that the gene defined by NM_013410, NM_203464, and NM_001005353 is located on chromosome 1. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.