Human AK4/AK 4/ AK3 ORF/cDNA clone-Lentivirus particle (NM_013410)
Pre-made Human AK4/AK 4/ AK3 Lentiviral expression plasmid for AK4 lentivirus packaging, AK4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to AK4/AK 4 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP002502 | Human AK4 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP002502 |
Gene Name | AK4 |
Accession Number | NM_013410 |
Gene ID | 205 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 672 bp |
Gene Alias | AK 4, AK3, AK3L1, AK3L2 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCTTCCAAACTCCTGCGCGCGGTCATCCTCGGGCCGCCCGGCTCGGGCAAGGGCACCGTGTGCCAGAGGATCGCCCAGAACTTTGGTCTCCAGCATCTCTCCAGCGGCCACTTCTTGCGGGAGAACATCAAGGCCAGCACCGAAGTTGGTGAGATGGCAAAGCAGTATATAGAGAAAAGTCTTTTGGTTCCAGACCATGTGATCACACGCCTAATGATGTCCGAGTTGGAGAACAGGCGTGGCCAGCACTGGCTCCTTGATGGTTTTCCTAGGACATTAGGACAAGCCGAAGCCCTGGACAAAATCTGTGAAGTGGATCTAGTGATCAGTTTGAATATTCCATTTGAAACACTTAAAGATCGTCTCAGCCGCCGTTGGATTCACCCTCCTAGCGGAAGGGTATATAACCTGGACTTCAATCCACCTCATGTACATGGTATTGATGACGTCACTGGTGAACCGTTAGTCCAGCAGGAGGATGATAAACCCGAAGCAGTTGCTGCCAGGCTAAGACAGTACAAAGACGTGGCAAAGCCAGTCATTGAATTATACAAGAGCCGAGGAGTGCTCCACCAATTTTCCGGAACGGAGACGAACAAAATCTGGCCCTACGTTTACACACTTTTCTCAAACAAGATCACACCTATTCAGTCCAAAGAAGCATATTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1556-Ab | Anti-KAD4/ AK4/ AK 4 functional antibody |
Target Antigen | GM-Tg-g-SE1556-Ag | AK4 protein |
ORF Viral Vector | pGMLP002502 | Human AK4 Lentivirus plasmid |
ORF Viral Vector | vGMLP002502 | Human AK4 Lentivirus particle |
Target information
Target ID | GM-SE1556 |
Target Name | AK4 |
Gene ID | 205, 11639, 698560, 29223, 101084638, 489554, 517063, 100069665 |
Gene Symbol and Synonyms | AK 4,Ak-3,Ak-4,AK3,AK3L1,AK3L2,AK4,D4Ertd274e |
Uniprot Accession | P27144 |
Uniprot Entry Name | KAD4_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000162433 |
Target Classification | Not Available |
This gene encodes a member of the adenylate kinase family of enzymes. The encoded protein is localized to the mitochondrial matrix. Adenylate kinases regulate the adenine and guanine nucleotide compositions within a cell by catalyzing the reversible transfer of phosphate group among these nucleotides. Five isozymes of adenylate kinase have been identified in vertebrates. Expression of these isozymes is tissue-specific and developmentally regulated. A pseudogene for this gene has been located on chromosome 17. Three transcript variants encoding the same protein have been identified for this gene. Sequence alignment suggests that the gene defined by NM_013410, NM_203464, and NM_001005353 is located on chromosome 1. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.