Human CDC42EP4/BORG4/CEP4 ORF/cDNA clone-Lentivirus plasmid (NM_012121)

Cat. No.: pGMLP002593
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CDC42EP4/BORG4/CEP4 Lentiviral expression plasmid for CDC42EP4 lentivirus packaging, CDC42EP4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to CDC42EP4/BORG4 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $599.88
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002593
Gene Name CDC42EP4
Accession Number NM_012121
Gene ID 23580
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1071 bp
Gene Alias BORG4,CEP4,KAIA1777
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCCAATCCTCAAGCAACTGGTGTCCAGCTCGGTGCACTCCAAGCGCCGTTCCCGAGCGGACCTCACGGCCGAGATGATCAGCGCCCCGCTGGGCGACTTCCGCCACACCATGCACGTTGGCCGGGCCGGAGACGCCTTTGGGGACACCTCCTTCCTCAATAGCAAGGCTGGCGAGCCCGACGGCGAGTCCTTGGACGAACAGCCCTCTTCTTCATCTTCCAAACGCAGTCTCCTGTCCAGGAAGTTCCGGGGCAGCAAGCGGTCACAGTCGGTGACCAGGGGGGAGCGGGAGCAGCGTGACATGCTGGGCTCCCTGCGGGACTCGGCCCTGTTTGTCAAGAATGCCATGTCCCTGCCCCAGCTCAATGAGAAGGAGGCCGCGGAGAAGGGCACCAGTAAGCTGCCCAAGAGCCTGTCATCCAGCCCCGTGAAGAAGGCCAATGACGGGGAGGGCGGCGATGAGGAGGCGGGCACGGAGGAGGCAGTGCCCCGTCGGAATGGGGCCGCGGGTCCACATTCCCCTGACCCCCTCCTCGATGAGCAGGCCTTTGGGGATCTGACAGATCTGCCTGTCGTGCCCAAGGCCACGTACGGGCTGAAGCATGCGGAGTCCATCATGTCCTTCCACATCGACCTGGGGCCCTCCATGCTGGGTGACGTCCTCAGCATCATGGACAAGGAGGAGTGGGACCCCGAGGAGGGGGAGGGTGGTTACCATGGCGATGAGGGCGCCGCTGGCACCATCACCCAGGCTCCCCCGTACGCCGTGGCGGCCCCTCCCCTGGCAAGGCAGGAAGGCAAGGCTGGCCCAGACTTGCCCTCCCTCCCCTCCCATGCTCTGGAGGATGAGGGGTGGGCAGCAGCGGCCCCCAGCCCCGGCTCAGCCCGCAGCATGGGCAGCCACACCACACGGGACAGCAGCTCCCTCTCCAGCTGCACCTCAGGCATCCTGGAGGAGCGCAGCCCTGCCTTCCGGGGGCCGGACAGGGCCCGGGCTGCTGTCTCAAGACAGCCAGACAAGGAGTTCTCCTTCATGGATGAGGAGGAGGAGGATGAAATCCGTGTGTGA
ORF Protein Sequence MPILKQLVSSSVHSKRRSRADLTAEMISAPLGDFRHTMHVGRAGDAFGDTSFLNSKAGEPDGESLDEQPSSSSSKRSLLSRKFRGSKRSQSVTRGEREQRDMLGSLRDSALFVKNAMSLPQLNEKEAAEKGTSKLPKSLSSSPVKKANDGEGGDEEAGTEEAVPRRNGAAGPHSPDPLLDEQAFGDLTDLPVVPKATYGLKHAESIMSFHIDLGPSMLGDVLSIMDKEEWDPEEGEGGYHGDEGAAGTITQAPPYAVAAPPLARQEGKAGPDLPSLPSHALEDEGWAAAAPSPGSARSMGSHTTRDSSSLSSCTSGILEERSPAFRGPDRARAAVSRQPDKEFSFMDEEEEDEIRV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2045-Ab Anti-BORG4/ CDC42EP4/ CEP4 monoclonal antibody
    Target Antigen GM-Tg-g-MP2045-Ag CDC42EP4 VLP (virus-like particle)
    ORF Viral Vector pGMLP002593 Human CDC42EP4 Lentivirus plasmid
    ORF Viral Vector vGMLP002593 Human CDC42EP4 Lentivirus particle


    Target information

    Target ID GM-MP2045
    Target Name CDC42EP4
    Gene ID 23580, 56699, 696227, 303653, 101092563, 475907, 540152, 100061186
    Gene Symbol and Synonyms 1500041M20Rik,BORG4,CDC42EP4,CEP4,KAIA1777
    Uniprot Accession Q9H3Q1
    Uniprot Entry Name BORG4_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000179604
    Target Classification Not Available

    The product of this gene is a member of the CDC42-binding protein family. Members of this family interact with Rho family GTPases and regulate the organization of the actin cytoskeleton. This protein has been shown to bind both CDC42 and TC10 GTPases in a GTP-dependent manner. When overexpressed in fibroblasts, this protein was able to induce pseudopodia formation, which suggested a role in inducing actin filament assembly and cell shape control. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.