Human EEF1A2/EEF1AL/ EF-1-alpha-2 ORF/cDNA clone-Lentivirus plasmid (NM_001958)

Pre-made Human EEF1A2/EEF1AL/ EF-1-alpha-2 Lentiviral expression plasmid for EEF1A2 lentivirus packaging, EEF1A2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to EEF1A2/EEF1AL products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002670 Human EEF1A2 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002670
Gene Name EEF1A2
Accession Number NM_001958
Gene ID 1917
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1392 bp
Gene Alias EEF1AL, EF-1-alpha-2, EF1A, EIEE33, HS1, MRD38, STN, STNL
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGCAAGGAGAAGACCCACATCAACATCGTGGTCATCGGCCACGTGGACTCCGGAAAGTCCACCACCACGGGCCACCTCATCTACAAATGCGGAGGTATTGACAAAAGGACCATTGAGAAGTTCGAGAAGGAGGCGGCTGAGATGGGGAAGGGATCCTTCAAGTATGCCTGGGTGCTGGACAAGCTGAAGGCGGAGCGTGAGCGCGGCATCACCATCGACATCTCCCTCTGGAAGTTCGAGACCACCAAGTACTACATCACCATCATCGATGCCCCCGGCCACCGCGACTTCATCAAGAACATGATCACGGGTACATCCCAGGCGGACTGCGCAGTGCTGATCGTGGCGGCGGGCGTGGGCGAGTTCGAGGCGGGCATCTCCAAGAATGGGCAGACGCGGGAGCATGCCCTGCTGGCCTACACGCTGGGTGTGAAGCAGCTCATCGTGGGCGTGAACAAAATGGACTCCACAGAGCCGGCCTACAGCGAGAAGCGCTACGACGAGATCGTCAAGGAAGTCAGCGCCTACATCAAGAAGATCGGCTACAACCCGGCCACCGTGCCCTTTGTGCCCATCTCCGGCTGGCACGGTGACAACATGCTGGAGCCCTCCCCCAACATGCCGTGGTTCAAGGGCTGGAAGGTGGAGCGTAAGGAGGGCAACGCAAGCGGCGTGTCCCTGCTGGAGGCCCTGGACACCATCCTGCCCCCCACGCGCCCCACGGACAAGCCCCTGCGCCTGCCGCTGCAGGACGTGTACAAGATTGGCGGCATTGGCACGGTGCCCGTGGGCCGGGTGGAGACCGGCATCCTGCGGCCGGGCATGGTGGTGACCTTTGCGCCAGTGAACATCACCACTGAGGTGAAGTCAGTGGAGATGCACCACGAGGCTCTGAGCGAAGCTCTGCCCGGCGACAACGTCGGCTTCAATGTGAAGAACGTGTCGGTGAAGGACATCCGGCGGGGCAACGTGTGTGGGGACAGCAAGTCTGACCCGCCGCAGGAGGCTGCTCAGTTCACCTCCCAGGTCATCATCCTGAACCACCCGGGGCAGATTAGCGCCGGCTACTCCCCGGTCATCGACTGCCACACAGCCCACATCGCCTGCAAGTTTGCGGAGCTGAAGGAGAAGATTGACCGGCGCTCTGGCAAGAAGCTGGAGGACAACCCCAAGTCCCTGAAGTCTGGAGACGCGGCCATCGTGGAGATGGTGCCGGGAAAGCCCATGTGTGTGGAGAGCTTCTCCCAGTACCCGCCTCTCGGCCGCTTCGCCGTGCGCGACATGAGGCAGACGGTGGCCGTAGGCGTCATCAAGAACGTGGAGAAGAAGAGCGGCGGCGCCGGCAAGGTCACCAAGTCGGCGCAGAAGGCGCAGAAGGCGGGCAAGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-TA126-Ab Anti-EEF1A2 monoclonal antibody
    Target Antigen GM-Tg-g-TA126-Ag EEF1A2 protein
    ORF Viral Vector pGMAD000134 Human EEF1A2 Adenovirus plasmid
    ORF Viral Vector pGMLP002670 Human EEF1A2 Lentivirus plasmid
    ORF Viral Vector vGMAD000134 Human EEF1A2 Adenovirus particle
    ORF Viral Vector vGMLP002670 Human EEF1A2 Lentivirus particle


    Target information

    Target ID GM-TA126
    Target Name EEF1A2
    Gene ID 1917, 13628, 696946, 24799, 101100798, 612521, 515233, 100060464
    Gene Symbol and Synonyms DEE33,Eef1a,EEF1A2,EEF1AL,EF-1-alpha-2,EF1A,EIEE33,HS1,MRD38,Ps10,RATPS10,S1,STN,STNL,wasted,wst
    Uniprot Accession Q05639
    Uniprot Entry Name EF1A2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Cancer
    Gene Ensembl ENSG00000101210
    Target Classification Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA)

    This gene encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 2) is expressed in brain, heart and skeletal muscle, and the other isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas. This gene may be critical in the development of ovarian cancer. [provided by RefSeq, Mar 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.