Human EEF1A2/EEF1AL/ EF-1-alpha-2 ORF/cDNA clone-Lentivirus particle (NM_001958)
Pre-made Human EEF1A2/EEF1AL/ EF-1-alpha-2 Lentiviral expression plasmid for EEF1A2 lentivirus packaging, EEF1A2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to EEF1A2/EEF1AL products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP002670 | Human EEF1A2 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP002670 |
Gene Name | EEF1A2 |
Accession Number | NM_001958 |
Gene ID | 1917 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1392 bp |
Gene Alias | EEF1AL, EF-1-alpha-2, EF1A, EIEE33, HS1, MRD38, STN, STNL |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGCAAGGAGAAGACCCACATCAACATCGTGGTCATCGGCCACGTGGACTCCGGAAAGTCCACCACCACGGGCCACCTCATCTACAAATGCGGAGGTATTGACAAAAGGACCATTGAGAAGTTCGAGAAGGAGGCGGCTGAGATGGGGAAGGGATCCTTCAAGTATGCCTGGGTGCTGGACAAGCTGAAGGCGGAGCGTGAGCGCGGCATCACCATCGACATCTCCCTCTGGAAGTTCGAGACCACCAAGTACTACATCACCATCATCGATGCCCCCGGCCACCGCGACTTCATCAAGAACATGATCACGGGTACATCCCAGGCGGACTGCGCAGTGCTGATCGTGGCGGCGGGCGTGGGCGAGTTCGAGGCGGGCATCTCCAAGAATGGGCAGACGCGGGAGCATGCCCTGCTGGCCTACACGCTGGGTGTGAAGCAGCTCATCGTGGGCGTGAACAAAATGGACTCCACAGAGCCGGCCTACAGCGAGAAGCGCTACGACGAGATCGTCAAGGAAGTCAGCGCCTACATCAAGAAGATCGGCTACAACCCGGCCACCGTGCCCTTTGTGCCCATCTCCGGCTGGCACGGTGACAACATGCTGGAGCCCTCCCCCAACATGCCGTGGTTCAAGGGCTGGAAGGTGGAGCGTAAGGAGGGCAACGCAAGCGGCGTGTCCCTGCTGGAGGCCCTGGACACCATCCTGCCCCCCACGCGCCCCACGGACAAGCCCCTGCGCCTGCCGCTGCAGGACGTGTACAAGATTGGCGGCATTGGCACGGTGCCCGTGGGCCGGGTGGAGACCGGCATCCTGCGGCCGGGCATGGTGGTGACCTTTGCGCCAGTGAACATCACCACTGAGGTGAAGTCAGTGGAGATGCACCACGAGGCTCTGAGCGAAGCTCTGCCCGGCGACAACGTCGGCTTCAATGTGAAGAACGTGTCGGTGAAGGACATCCGGCGGGGCAACGTGTGTGGGGACAGCAAGTCTGACCCGCCGCAGGAGGCTGCTCAGTTCACCTCCCAGGTCATCATCCTGAACCACCCGGGGCAGATTAGCGCCGGCTACTCCCCGGTCATCGACTGCCACACAGCCCACATCGCCTGCAAGTTTGCGGAGCTGAAGGAGAAGATTGACCGGCGCTCTGGCAAGAAGCTGGAGGACAACCCCAAGTCCCTGAAGTCTGGAGACGCGGCCATCGTGGAGATGGTGCCGGGAAAGCCCATGTGTGTGGAGAGCTTCTCCCAGTACCCGCCTCTCGGCCGCTTCGCCGTGCGCGACATGAGGCAGACGGTGGCCGTAGGCGTCATCAAGAACGTGGAGAAGAAGAGCGGCGGCGCCGGCAAGGTCACCAAGTCGGCGCAGAAGGCGCAGAAGGCGGGCAAGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-TA126-Ab | Anti-EEF1A2 monoclonal antibody |
Target Antigen | GM-Tg-g-TA126-Ag | EEF1A2 protein |
ORF Viral Vector | pGMAD000134 | Human EEF1A2 Adenovirus plasmid |
ORF Viral Vector | pGMLP002670 | Human EEF1A2 Lentivirus plasmid |
ORF Viral Vector | vGMAD000134 | Human EEF1A2 Adenovirus particle |
ORF Viral Vector | vGMLP002670 | Human EEF1A2 Lentivirus particle |
Target information
Target ID | GM-TA126 |
Target Name | EEF1A2 |
Gene ID | 1917, 13628, 696946, 24799, 101100798, 612521, 515233, 100060464 |
Gene Symbol and Synonyms | DEE33,Eef1a,EEF1A2,EEF1AL,EF-1-alpha-2,EF1A,EIEE33,HS1,MRD38,Ps10,RATPS10,S1,STN,STNL,wasted,wst |
Uniprot Accession | Q05639 |
Uniprot Entry Name | EF1A2_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target, Immuno-oncology Target |
Disease | Cancer |
Gene Ensembl | ENSG00000101210 |
Target Classification | Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA) |
This gene encodes an isoform of the alpha subunit of the elongation factor-1 complex, which is responsible for the enzymatic delivery of aminoacyl tRNAs to the ribosome. This isoform (alpha 2) is expressed in brain, heart and skeletal muscle, and the other isoform (alpha 1) is expressed in brain, placenta, lung, liver, kidney, and pancreas. This gene may be critical in the development of ovarian cancer. [provided by RefSeq, Mar 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.