Human TSG101/TSG10/VPS23 ORF/cDNA clone-Lentivirus plasmid (NM_006292)

Cat. No.: pGMLP002702
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TSG101/TSG10/VPS23 Lentiviral expression plasmid for TSG101 lentivirus packaging, TSG101 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to TSG101/TSG10 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $628.44
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP002702
Gene Name TSG101
Accession Number NM_006292
Gene ID 7251
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1173 bp
Gene Alias TSG10,VPS23
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGGTGTCGGAGAGCCAGCTCAAGAAAATGGTGTCCAAGTACAAATACAGAGACCTAACTGTACGTGAAACTGTCAATGTTATTACTCTATACAAAGATCTCAAACCTGTTTTGGATTCATATGTTTTTAACGATGGCAGTTCCAGGGAACTAATGAACCTCACTGGAACAATCCCTGTGCCTTATAGAGGTAATACATACAATATTCCAATATGCCTATGGCTACTGGACACATACCCATATAATCCCCCTATCTGTTTTGTTAAGCCTACTAGTTCAATGACTATTAAAACAGGAAAGCATGTTGATGCAAATGGGAAGATATATCTTCCTTATCTACATGAATGGAAACACCCACAGTCAGACTTGTTGGGGCTTATTCAGGTCATGATTGTGGTATTTGGAGATGAACCTCCAGTCTTCTCTCGTCCTATTTCGGCATCCTATCCGCCATACCAGGCAACGGGGCCACCAAATACTTCCTACATGCCAGGCATGCCAGGTGGAATCTCTCCATACCCATCCGGATACCCTCCCAATCCCAGTGGTTACCCAGGCTGTCCTTACCCACCTGGTGGTCCATATCCTGCCACAACAAGTTCTCAGTACCCTTCTCAGCCTCCTGTGACCACTGTTGGTCCCAGTAGGGATGGCACAATCAGCGAGGACACCATCCGAGCCTCTCTCATCTCTGCGGTCAGTGACAAACTGAGATGGCGGATGAAGGAGGAAATGGATCGTGCCCAGGCAGAGCTCAATGCCTTGAAACGAACAGAAGAAGACCTGAAAAAGGGTCACCAGAAACTGGAAGAGATGGTTACCCGTTTAGATCAAGAAGTAGCCGAGGTTGATAAAAACATAGAACTTTTGAAAAAGAAGGATGAAGAACTCAGTTCTGCTCTGGAAAAAATGGAAAATCAGTCTGAAAACAATGATATCGATGAAGTTATCATTCCCACAGCTCCCTTATACAAACAGATCCTGAATCTGTATGCAGAAGAAAACGCTATTGAAGACACTATCTTTTACTTGGGAGAAGCCTTGAGAAGGGGCGTGATAGACCTGGATGTCTTCCTGAAGCATGTACGTCTTCTGTCCCGTAAACAGTTCCAGCTGAGGGCACTAATGCAAAAAGCAAGAAAGACTGCCGGTCTCAGTGACCTCTACTGA
ORF Protein Sequence MAVSESQLKKMVSKYKYRDLTVRETVNVITLYKDLKPVLDSYVFNDGSSRELMNLTGTIPVPYRGNTYNIPICLWLLDTYPYNPPICFVKPTSSMTIKTGKHVDANGKIYLPYLHEWKHPQSDLLGLIQVMIVVFGDEPPVFSRPISASYPPYQATGPPNTSYMPGMPGGISPYPSGYPPNPSGYPGCPYPPGGPYPATTSSQYPSQPPVTTVGPSRDGTISEDTIRASLISAVSDKLRWRMKEEMDRAQAELNALKRTEEDLKKGHQKLEEMVTRLDQEVAEVDKNIELLKKKDEELSSALEKMENQSENNDIDEVIIPTAPLYKQILNLYAEENAIEDTIFYLGEALRRGVIDLDVFLKHVRLLSRKQFQLRALMQKARKTAGLSDLY

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T01283-Ab Anti-TS101/ TSG101/ TSG10 monoclonal antibody
    Target Antigen GM-Tg-g-T01283-Ag TSG101 VLP (virus-like particle)
    ORF Viral Vector pGMLP002702 Human TSG101 Lentivirus plasmid
    ORF Viral Vector vGMLP002702 Human TSG101 Lentivirus particle


    Target information

    Target ID GM-T01283
    Target Name TSG101
    Gene ID 7251, 22088, 693787, 292925, 101100915, 485406, 507659, 100057099
    Gene Symbol and Synonyms CC2,Rw,TSG10,TSG101,VPS23
    Uniprot Accession Q99816
    Uniprot Entry Name TS101_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000074319
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene belongs to a group of apparently inactive homologs of ubiquitin-conjugating enzymes. The gene product contains a coiled-coil domain that interacts with stathmin, a cytosolic phosphoprotein implicated in tumorigenesis. The protein may play a role in cell growth and differentiation and act as a negative growth regulator. In vitro steady-state expression of this tumor susceptibility gene appears to be important for maintenance of genomic stability and cell cycle regulation. Mutations and alternative splicing in this gene occur in high frequency in breast cancer and suggest that defects occur during breast cancer tumorigenesis and/or progression. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.