Human TSG101/TSG10/VPS23 ORF/cDNA clone-Lentivirus particle (NM_006292)
Cat. No.: vGMLP002702
Pre-made Human TSG101/TSG10/VPS23 Lentiviral expression plasmid for TSG101 lentivirus packaging, TSG101 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
TSG101/TSG10 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP002702 | Human TSG101 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP002702 |
Gene Name | TSG101 |
Accession Number | NM_006292 |
Gene ID | 7251 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1173 bp |
Gene Alias | TSG10,VPS23 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCGGTGTCGGAGAGCCAGCTCAAGAAAATGGTGTCCAAGTACAAATACAGAGACCTAACTGTACGTGAAACTGTCAATGTTATTACTCTATACAAAGATCTCAAACCTGTTTTGGATTCATATGTTTTTAACGATGGCAGTTCCAGGGAACTAATGAACCTCACTGGAACAATCCCTGTGCCTTATAGAGGTAATACATACAATATTCCAATATGCCTATGGCTACTGGACACATACCCATATAATCCCCCTATCTGTTTTGTTAAGCCTACTAGTTCAATGACTATTAAAACAGGAAAGCATGTTGATGCAAATGGGAAGATATATCTTCCTTATCTACATGAATGGAAACACCCACAGTCAGACTTGTTGGGGCTTATTCAGGTCATGATTGTGGTATTTGGAGATGAACCTCCAGTCTTCTCTCGTCCTATTTCGGCATCCTATCCGCCATACCAGGCAACGGGGCCACCAAATACTTCCTACATGCCAGGCATGCCAGGTGGAATCTCTCCATACCCATCCGGATACCCTCCCAATCCCAGTGGTTACCCAGGCTGTCCTTACCCACCTGGTGGTCCATATCCTGCCACAACAAGTTCTCAGTACCCTTCTCAGCCTCCTGTGACCACTGTTGGTCCCAGTAGGGATGGCACAATCAGCGAGGACACCATCCGAGCCTCTCTCATCTCTGCGGTCAGTGACAAACTGAGATGGCGGATGAAGGAGGAAATGGATCGTGCCCAGGCAGAGCTCAATGCCTTGAAACGAACAGAAGAAGACCTGAAAAAGGGTCACCAGAAACTGGAAGAGATGGTTACCCGTTTAGATCAAGAAGTAGCCGAGGTTGATAAAAACATAGAACTTTTGAAAAAGAAGGATGAAGAACTCAGTTCTGCTCTGGAAAAAATGGAAAATCAGTCTGAAAACAATGATATCGATGAAGTTATCATTCCCACAGCTCCCTTATACAAACAGATCCTGAATCTGTATGCAGAAGAAAACGCTATTGAAGACACTATCTTTTACTTGGGAGAAGCCTTGAGAAGGGGCGTGATAGACCTGGATGTCTTCCTGAAGCATGTACGTCTTCTGTCCCGTAAACAGTTCCAGCTGAGGGCACTAATGCAAAAAGCAAGAAAGACTGCCGGTCTCAGTGACCTCTACTGA |
ORF Protein Sequence | MAVSESQLKKMVSKYKYRDLTVRETVNVITLYKDLKPVLDSYVFNDGSSRELMNLTGTIPVPYRGNTYNIPICLWLLDTYPYNPPICFVKPTSSMTIKTGKHVDANGKIYLPYLHEWKHPQSDLLGLIQVMIVVFGDEPPVFSRPISASYPPYQATGPPNTSYMPGMPGGISPYPSGYPPNPSGYPGCPYPPGGPYPATTSSQYPSQPPVTTVGPSRDGTISEDTIRASLISAVSDKLRWRMKEEMDRAQAELNALKRTEEDLKKGHQKLEEMVTRLDQEVAEVDKNIELLKKKDEELSSALEKMENQSENNDIDEVIIPTAPLYKQILNLYAEENAIEDTIFYLGEALRRGVIDLDVFLKHVRLLSRKQFQLRALMQKARKTAGLSDLY |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T01283-Ab | Anti-TS101/ TSG101/ TSG10 monoclonal antibody |
Target Antigen | GM-Tg-g-T01283-Ag | TSG101 VLP (virus-like particle) |
ORF Viral Vector | pGMLP002702 | Human TSG101 Lentivirus plasmid |
ORF Viral Vector | vGMLP002702 | Human TSG101 Lentivirus particle |
Target information
Target ID | GM-T01283 |
Target Name | TSG101 |
Gene ID | 7251, 22088, 693787, 292925, 101100915, 485406, 507659, 100057099 |
Gene Symbol and Synonyms | CC2,Rw,TSG10,TSG101,VPS23 |
Uniprot Accession | Q99816 |
Uniprot Entry Name | TS101_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000074319 |
Target Classification | Tumor-associated antigen (TAA) |
The protein encoded by this gene belongs to a group of apparently inactive homologs of ubiquitin-conjugating enzymes. The gene product contains a coiled-coil domain that interacts with stathmin, a cytosolic phosphoprotein implicated in tumorigenesis. The protein may play a role in cell growth and differentiation and act as a negative growth regulator. In vitro steady-state expression of this tumor susceptibility gene appears to be important for maintenance of genomic stability and cell cycle regulation. Mutations and alternative splicing in this gene occur in high frequency in breast cancer and suggest that defects occur during breast cancer tumorigenesis and/or progression. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.