Human ANGPT1/AGP1/AGPT ORF/cDNA clone-Lentivirus plasmid (NM_001146)
Cat. No.: pGMLP002711
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human ANGPT1/AGP1/AGPT Lentiviral expression plasmid for ANGPT1 lentivirus packaging, ANGPT1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
ANGPT1/AGP1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP002711 |
Gene Name | ANGPT1 |
Accession Number | NM_001146 |
Gene ID | 284 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1497 bp |
Gene Alias | AGP1,AGPT,ANG1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGACAGTTTTCCTTTCCTTTGCTTTCCTCGCTGCCATTCTGACTCACATAGGGTGCAGCAATCAGCGCCGAAGTCCAGAAAACAGTGGGAGAAGATATAACCGGATTCAACATGGGCAATGTGCCTACACTTTCATTCTTCCAGAACACGATGGCAACTGTCGTGAGAGTACGACAGACCAGTACAACACAAACGCTCTGCAGAGAGATGCTCCACACGTGGAACCGGATTTCTCTTCCCAGAAACTTCAACATCTGGAACATGTGATGGAAAATTATACTCAGTGGCTGCAAAAACTTGAGAATTACATTGTGGAAAACATGAAGTCGGAGATGGCCCAGATACAGCAGAATGCAGTTCAGAACCACACGGCTACCATGCTGGAGATAGGAACCAGCCTCCTCTCTCAGACTGCAGAGCAGACCAGAAAGCTGACAGATGTTGAGACCCAGGTACTAAATCAAACTTCTCGACTTGAGATACAGCTGCTGGAGAATTCATTATCCACCTACAAGCTAGAGAAGCAACTTCTTCAACAGACAAATGAAATCTTGAAGATCCATGAAAAAAACAGTTTATTAGAACATAAAATCTTAGAAATGGAAGGAAAACACAAGGAAGAGTTGGACACCTTAAAGGAAGAGAAAGAGAACCTTCAAGGCTTGGTTACTCGTCAAACATATATAATCCAGGAGCTGGAAAAGCAATTAAACAGAGCTACCACCAACAACAGTGTCCTTCAGAAGCAGCAACTGGAGCTGATGGACACAGTCCACAACCTTGTCAATCTTTGCACTAAAGAAGGTGTTTTACTAAAGGGAGGAAAAAGAGAGGAAGAGAAACCATTTAGAGACTGTGCAGATGTATATCAAGCTGGTTTTAATAAAAGTGGAATCTACACTATTTATATTAATAATATGCCAGAACCCAAAAAGGTGTTTTGCAATATGGATGTCAATGGGGGAGGTTGGACTGTAATACAACATCGTGAAGATGGAAGTCTAGATTTCCAAAGAGGCTGGAAGGAATATAAAATGGGTTTTGGAAATCCCTCCGGTGAATATTGGCTGGGGAATGAGTTTATTTTTGCCATTACCAGTCAGAGGCAGTACATGCTAAGAATTGAGTTAATGGACTGGGAAGGGAACCGAGCCTATTCACAGTATGACAGATTCCACATAGGAAATGAAAAGCAAAACTATAGGTTGTATTTAAAAGGTCACACTGGGACAGCAGGAAAACAGAGCAGCCTGATCTTACACGGTGCTGATTTCAGCACTAAAGATGCTGATAATGACAACTGTATGTGCAAATGTGCCCTCATGTTAACAGGAGGATGGTGGTTTGATGCTTGTGGCCCCTCCAATCTAAATGGAATGTTCTATACTGCGGGACAAAACCATGGAAAACTGAATGGGATAAAGTGGCACTACTTCAAAGGGCCCAGTTACTCCTTACGTTCCACAACTATGATGATTCGACCTTTAGATTTTTGA |
ORF Protein Sequence | MTVFLSFAFLAAILTHIGCSNQRRSPENSGRRYNRIQHGQCAYTFILPEHDGNCRESTTDQYNTNALQRDAPHVEPDFSSQKLQHLEHVMENYTQWLQKLENYIVENMKSEMAQIQQNAVQNHTATMLEIGTSLLSQTAEQTRKLTDVETQVLNQTSRLEIQLLENSLSTYKLEKQLLQQTNEILKIHEKNSLLEHKILEMEGKHKEELDTLKEEKENLQGLVTRQTYIIQELEKQLNRATTNNSVLQKQQLELMDTVHNLVNLCTKEGVLLKGGKREEEKPFRDCADVYQAGFNKSGIYTIYINNMPEPKKVFCNMDVNGGGWTVIQHREDGSLDFQRGWKEYKMGFGNPSGEYWLGNEFIFAITSQRQYMLRIELMDWEGNRAYSQYDRFHIGNEKQNYRLYLKGHTGTAGKQSSLILHGADFSTKDADNDNCMCKCALMLTGGWWFDACGPSNLNGMFYTAGQNHGKLNGIKWHYFKGPSYSLRSTTMMIRPLDF |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T44141-Ab | Anti-ANGP1/ ANGPT1/ AGP1 monoclonal antibody |
Target Antigen | GM-Tg-g-T44141-Ag | ANGPT1 VLP (virus-like particle) |
ORF Viral Vector | pGMLP002711 | Human ANGPT1 Lentivirus plasmid |
ORF Viral Vector | pGMLP004102 | Human ANGPT1 Lentivirus plasmid |
ORF Viral Vector | pGMLV000665 | Human ANGPT1 Lentivirus plasmid |
ORF Viral Vector | pGMLV001231 | Human ANGPT1 Lentivirus plasmid |
ORF Viral Vector | pGMLPm004015 | Human ANGPT1 Lentivirus plasmid |
ORF Viral Vector | pGMPC000824 | Human ANGPT1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLP002711 | Human ANGPT1 Lentivirus particle |
ORF Viral Vector | vGMLP004102 | Human ANGPT1 Lentivirus particle |
ORF Viral Vector | vGMLV000665 | Human ANGPT1 Lentivirus particle |
ORF Viral Vector | vGMLV001231 | Human ANGPT1 Lentivirus particle |
ORF Viral Vector | vGMLPm004015 | Human ANGPT1 Lentivirus particle |
Target information
Target ID | GM-T44141 |
Target Name | ANGPT1 |
Gene ID | 284, 11600, 697017, 89807, 101087130, 403656, 282140, 100056482 |
Gene Symbol and Synonyms | 1110046O21Rik,AGP1,AGPT,AGPT-1,Agpt1,Ang-1,ANG1,ANGPT1,HAE5 |
Uniprot Accession | Q15389 |
Uniprot Entry Name | ANGP1_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | breast cancer |
Gene Ensembl | ENSG00000154188 |
Target Classification | Not Available |
This gene encodes a secreted glycoprotein that belongs to the angiopoietin family. Members of this family play important roles in vascular development and angiogenesis. All angiopoietins bind with similar affinity to an endothelial cell-specific tyrosine-protein kinase receptor. The protein encoded by this gene is a secreted glycoprotein that activates the receptor by inducing its tyrosine phosphorylation. It plays a critical role in mediating reciprocal interactions between the endothelium and surrounding matrix and mesenchyme and inhibits endothelial permeability. The protein also contributes to blood vessel maturation and stability, and may be involved in early development of the heart. Mutations in this gene are associated with hereditary angioedema. [provided by RefSeq, Aug 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.