Human ANGPT1/AGP1/AGPT ORF/cDNA clone-Lentivirus particle (NM_001146.4)

Cat. No.: vGMLPm004015

Pre-made Human ANGPT1/AGP1/AGPT Lentiviral expression plasmid for ANGPT1 lentivirus packaging, ANGPT1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to ANGPT1/AGP1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLPm004015 Human ANGPT1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLPm004015
Gene Name ANGPT1
Accession Number NM_001146.4
Gene ID 284
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1497 bp
Gene Alias AGP1,AGPT,ANG1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGACAGTTTTCCTTTCCTTTGCTTTCCTCGCTGCCATTCTGACTCACATAGGGTGCAGCAATCAGCGCCGAAGTCCAGAAAACAGTGGGAGAAGATATAACCGGATTCAACATGGGCAATGTGCCTACACTTTCATTCTTCCAGAACACGATGGCAACTGTCGTGAGAGTACGACAGACCAGTACAACACAAACGCTCTGCAGAGAGATGCTCCACACGTGGAACCGGATTTCTCTTCCCAGAAACTTCAACATCTGGAACATGTGATGGAAAATTATACTCAGTGGCTGCAAAAACTTGAGAATTACATTGTGGAAAACATGAAGTCGGAGATGGCCCAGATACAGCAGAATGCAGTTCAGAACCACACGGCTACCATGCTGGAGATAGGAACCAGCCTCCTCTCTCAGACTGCAGAGCAGACCAGAAAGCTGACAGATGTTGAGACCCAGGTACTAAATCAAACTTCTCGACTTGAGATACAGCTGCTGGAGAATTCATTATCCACCTACAAGCTAGAGAAGCAACTTCTTCAACAGACAAATGAAATCTTGAAGATCCATGAAAAAAACAGTTTATTAGAACATAAAATCTTAGAAATGGAAGGAAAACACAAGGAAGAGTTGGACACCTTAAAGGAAGAGAAAGAGAACCTTCAAGGCTTGGTTACTCGTCAAACATATATAATCCAGGAGCTGGAAAAGCAATTAAACAGAGCTACCACCAACAACAGTGTCCTTCAGAAGCAGCAACTGGAGCTGATGGACACAGTCCACAACCTTGTCAATCTTTGCACTAAAGAAGGTGTTTTACTAAAGGGAGGAAAAAGAGAGGAAGAGAAACCATTTAGAGACTGTGCAGATGTATATCAAGCTGGTTTTAATAAAAGTGGAATCTACACTATTTATATTAATAATATGCCAGAACCCAAAAAGGTGTTTTGCAATATGGATGTCAATGGGGGAGGTTGGACTGTAATACAACATCGTGAAGATGGAAGTCTAGATTTCCAAAGAGGCTGGAAGGAATATAAAATGGGTTTTGGAAATCCCTCCGGTGAATATTGGCTGGGGAATGAGTTTATTTTTGCCATTACCAGTCAGAGGCAGTACATGCTAAGAATTGAGTTAATGGACTGGGAAGGGAACCGAGCCTATTCACAGTATGACAGATTCCACATAGGAAATGAAAAGCAAAACTATAGGTTGTATTTAAAAGGTCACACTGGGACAGCAGGAAAACAGAGCAGCCTGATCTTACACGGTGCTGATTTCAGCACTAAAGATGCTGATAATGACAACTGTATGTGCAAATGTGCCCTCATGTTAACAGGAGGATGGTGGTTTGATGCTTGTGGCCCCTCCAATCTAAATGGAATGTTCTATACTGCGGGACAAAACCATGGAAAACTGAATGGGATAAAGTGGCACTACTTCAAAGGGCCCAGTTACTCCTTACGTTCCACAACTATGATGATTCGACCTTTAGATTTTTGA
ORF Protein Sequence MTVFLSFAFLAAILTHIGCSNQRRSPENSGRRYNRIQHGQCAYTFILPEHDGNCRESTTDQYNTNALQRDAPHVEPDFSSQKLQHLEHVMENYTQWLQKLENYIVENMKSEMAQIQQNAVQNHTATMLEIGTSLLSQTAEQTRKLTDVETQVLNQTSRLEIQLLENSLSTYKLEKQLLQQTNEILKIHEKNSLLEHKILEMEGKHKEELDTLKEEKENLQGLVTRQTYIIQELEKQLNRATTNNSVLQKQQLELMDTVHNLVNLCTKEGVLLKGGKREEEKPFRDCADVYQAGFNKSGIYTIYINNMPEPKKVFCNMDVNGGGWTVIQHREDGSLDFQRGWKEYKMGFGNPSGEYWLGNEFIFAITSQRQYMLRIELMDWEGNRAYSQYDRFHIGNEKQNYRLYLKGHTGTAGKQSSLILHGADFSTKDADNDNCMCKCALMLTGGWWFDACGPSNLNGMFYTAGQNHGKLNGIKWHYFKGPSYSLRSTTMMIRPLDF

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T44141-Ab Anti-ANGP1/ ANGPT1/ AGP1 monoclonal antibody
    Target Antigen GM-Tg-g-T44141-Ag ANGPT1 VLP (virus-like particle)
    ORF Viral Vector pGMLP002711 Human ANGPT1 Lentivirus plasmid
    ORF Viral Vector pGMLP004102 Human ANGPT1 Lentivirus plasmid
    ORF Viral Vector pGMLV000665 Human ANGPT1 Lentivirus plasmid
    ORF Viral Vector pGMLV001231 Human ANGPT1 Lentivirus plasmid
    ORF Viral Vector pGMLPm004015 Human ANGPT1 Lentivirus plasmid
    ORF Viral Vector pGMPC000824 Human ANGPT1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP002711 Human ANGPT1 Lentivirus particle
    ORF Viral Vector vGMLP004102 Human ANGPT1 Lentivirus particle
    ORF Viral Vector vGMLV000665 Human ANGPT1 Lentivirus particle
    ORF Viral Vector vGMLV001231 Human ANGPT1 Lentivirus particle
    ORF Viral Vector vGMLPm004015 Human ANGPT1 Lentivirus particle


    Target information

    Target ID GM-T44141
    Target Name ANGPT1
    Gene ID 284, 11600, 697017, 89807, 101087130, 403656, 282140, 100056482
    Gene Symbol and Synonyms 1110046O21Rik,AGP1,AGPT,AGPT-1,Agpt1,Ang-1,ANG1,ANGPT1,HAE5
    Uniprot Accession Q15389
    Uniprot Entry Name ANGP1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease breast cancer
    Gene Ensembl ENSG00000154188
    Target Classification Not Available

    This gene encodes a secreted glycoprotein that belongs to the angiopoietin family. Members of this family play important roles in vascular development and angiogenesis. All angiopoietins bind with similar affinity to an endothelial cell-specific tyrosine-protein kinase receptor. The protein encoded by this gene is a secreted glycoprotein that activates the receptor by inducing its tyrosine phosphorylation. It plays a critical role in mediating reciprocal interactions between the endothelium and surrounding matrix and mesenchyme and inhibits endothelial permeability. The protein also contributes to blood vessel maturation and stability, and may be involved in early development of the heart. Mutations in this gene are associated with hereditary angioedema. [provided by RefSeq, Aug 2020]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.