Human BCL2/Bcl-2/ PPP1R50 ORF/cDNA clone-Lentivirus plasmid (NM_000633)

Pre-made Human BCL2/Bcl-2/ PPP1R50 Lentiviral expression plasmid for BCL2 lentivirus packaging, BCL2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to BCL-2/BCL2/Bcl-2 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002721 Human BCL2 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002721
Gene Name BCL2
Accession Number NM_000633
Gene ID 596
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 720 bp
Gene Alias Bcl-2, PPP1R50
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCGCACGCTGGGAGAACAGGGTACGATAACCGGGAGATAGTGATGAAGTACATCCATTATAAGCTGTCGCAGAGGGGCTACGAGTGGGATGCGGGAGATGTGGGCGCCGCGCCCCCGGGGGCCGCCCCCGCACCGGGCATCTTCTCCTCCCAGCCCGGGCACACGCCCCATCCAGCCGCATCCCGGGACCCGGTCGCCAGGACCTCGCCGCTGCAGACCCCGGCTGCCCCCGGCGCCGCCGCGGGGCCTGCGCTCAGCCCGGTGCCACCTGTGGTCCACCTGACCCTCCGCCAGGCCGGCGACGACTTCTCCCGCCGCTACCGCCGCGACTTCGCCGAGATGTCCAGCCAGCTGCACCTGACGCCCTTCACCGCGCGGGGACGCTTTGCCACGGTGGTGGAGGAGCTCTTCAGGGACGGGGTGAACTGGGGGAGGATTGTGGCCTTCTTTGAGTTCGGTGGGGTCATGTGTGTGGAGAGCGTCAACCGGGAGATGTCGCCCCTGGTGGACAACATCGCCCTGTGGATGACTGAGTACCTGAACCGGCACCTGCACACCTGGATCCAGGATAACGGAGGCTGGGATGCCTTTGTGGAACTGTACGGCCCCAGCATGCGGCCTCTGTTTGATTTCTCCTGGCTGTCTCTGAAGACTCTGCTCAGTTTGGCCCTGGTGGGAGCTTGCATCACCCTGGGTGCCTATCTGGGCCACAAGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0014-Ab Anti-BCL-2 monoclonal antibody
    Target Antigen GM-Tg-g-IP0014-Ag BCL-2/BCL2 protein
    ORF Viral Vector pGMPC000248 Human BCL2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000848 Human BCL2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP002721 Human BCL2 Lentivirus plasmid
    ORF Viral Vector pGMLP-SPh-016 Human BCL2 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-156 Human BCL2 Adenovirus plasmid
    ORF Viral Vector vGMLP002721 Human BCL2 Lentivirus particle
    ORF Viral Vector vGMLP-SPh-016 Human BCL2 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-156 Human BCL2 Adenovirus particle


    Target information

    Target ID GM-IP0014
    Target Name BCL-2
    Gene ID 596, 12043, 707407, 24224, 493934, 403416, 281020, 100050934
    Gene Symbol and Synonyms Bcl-2,BCL2,C430015F12Rik,D630044D05Rik,D830018M01Rik,PPP1R50
    Uniprot Accession P10415
    Uniprot Entry Name BCL2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Breast Cancer, immune cells or tumors
    Gene Ensembl ENSG00000171791
    Target Classification Checkpoint-Immuno Oncology, Apoptosis

    This gene encodes an integral outer mitochondrial membrane protein that blocks the apoptotic death of some cells such as lymphocytes. Constitutive expression of BCL2, such as in the case of translocation of BCL2 to Ig heavy chain locus, is thought to be the cause of follicular lymphoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.