Human BCL2/Bcl-2/ PPP1R50 ORF/cDNA clone-Lentivirus particle (NM_000633)
Pre-made Human BCL2/Bcl-2/ PPP1R50 Lentiviral expression plasmid for BCL2 lentivirus packaging, BCL2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to BCL-2/BCL2/Bcl-2 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP-SPh-016 | Human BCL2 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP-SPh-016 |
Gene Name | BCL2 |
Accession Number | NM_000633 |
Gene ID | 596 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 720 bp |
Gene Alias | Bcl-2, PPP1R50 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCGCACGCTGGGAGAACAGGGTACGATAACCGGGAGATAGTGATGAAGTACATCCATTATAAGCTGTCGCAGAGGGGCTACGAGTGGGATGCGGGAGATGTGGGCGCCGCGCCCCCGGGGGCCGCCCCCGCACCGGGCATCTTCTCCTCCCAGCCCGGGCACACGCCCCATCCAGCCGCATCCCGGGACCCGGTCGCCAGGACCTCGCCGCTGCAGACCCCGGCTGCCCCCGGCGCCGCCGCGGGGCCTGCGCTCAGCCCGGTGCCACCTGTGGTCCACCTGACCCTCCGCCAGGCCGGCGACGACTTCTCCCGCCGCTACCGCCGCGACTTCGCCGAGATGTCCAGCCAGCTGCACCTGACGCCCTTCACCGCGCGGGGACGCTTTGCCACGGTGGTGGAGGAGCTCTTCAGGGACGGGGTGAACTGGGGGAGGATTGTGGCCTTCTTTGAGTTCGGTGGGGTCATGTGTGTGGAGAGCGTCAACCGGGAGATGTCGCCCCTGGTGGACAACATCGCCCTGTGGATGACTGAGTACCTGAACCGGCACCTGCACACCTGGATCCAGGATAACGGAGGCTGGGATGCCTTTGTGGAACTGTACGGCCCCAGCATGCGGCCTCTGTTTGATTTCTCCTGGCTGTCTCTGAAGACTCTGCTCAGTTTGGCCCTGGTGGGAGCTTGCATCACCCTGGGTGCCTATCTGGGCCACAAGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0014-Ab | Anti-BCL-2 monoclonal antibody |
Target Antigen | GM-Tg-g-IP0014-Ag | BCL-2/BCL2 protein |
ORF Viral Vector | pGMPC000248 | Human BCL2 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC000848 | Human BCL2 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP002721 | Human BCL2 Lentivirus plasmid |
ORF Viral Vector | pGMLP-SPh-016 | Human BCL2 Lentivirus plasmid |
ORF Viral Vector | pGMAP-SPh-156 | Human BCL2 Adenovirus plasmid |
ORF Viral Vector | vGMLP002721 | Human BCL2 Lentivirus particle |
ORF Viral Vector | vGMLP-SPh-016 | Human BCL2 Lentivirus particle |
ORF Viral Vector | vGMAP-SPh-156 | Human BCL2 Adenovirus particle |
Target information
Target ID | GM-IP0014 |
Target Name | BCL-2 |
Gene ID | 596, 12043, 707407, 24224, 493934, 403416, 281020, 100050934 |
Gene Symbol and Synonyms | Bcl-2,BCL2,C430015F12Rik,D630044D05Rik,D830018M01Rik,PPP1R50 |
Uniprot Accession | P10415 |
Uniprot Entry Name | BCL2_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target, Immuno-oncology Target |
Disease | Breast Cancer, immune cells or tumors |
Gene Ensembl | ENSG00000171791 |
Target Classification | Checkpoint-Immuno Oncology, Apoptosis |
This gene encodes an integral outer mitochondrial membrane protein that blocks the apoptotic death of some cells such as lymphocytes. Constitutive expression of BCL2, such as in the case of translocation of BCL2 to Ig heavy chain locus, is thought to be the cause of follicular lymphoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.