Human BDKRB1/B1BKR/B1R ORF/cDNA clone-Lentivirus plasmid (NM_000710)
Cat. No.: pGMLP002722
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human BDKRB1/B1BKR/B1R Lentiviral expression plasmid for BDKRB1 lentivirus packaging, BDKRB1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
BDKRB1/B1BKR products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP002722 |
Gene Name | BDKRB1 |
Accession Number | NM_000710 |
Gene ID | 623 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1062 bp |
Gene Alias | B1BKR,B1R,BDKRB2,BKB1R,BKR1,BRADYB1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCATCATCCTGGCCCCCTCTAGAGCTCCAATCCTCCAACCAGAGCCAGCTCTTCCCTCAAAATGCTACGGCCTGTGACAATGCTCCAGAAGCCTGGGACCTGCTGCACAGAGTGCTGCCAACATTTATCATCTCCATCTGTTTCTTCGGCCTCCTAGGGAACCTTTTTGTCCTGTTGGTCTTCCTCCTGCCCCGGCGGCAACTGAACGTGGCAGAAATCTACCTGGCCAACCTGGCAGCCTCTGATCTGGTGTTTGTCTTGGGCTTGCCCTTCTGGGCAGAGAATATCTGGAACCAGTTTAACTGGCCTTTCGGAGCCCTCCTCTGCCGTGTCATCAACGGGGTCATCAAGGCCAATTTGTTCATCAGCATCTTCCTGGTGGTGGCCATCAGCCAGGACCGCTACCGCGTGCTGGTGCACCCTATGGCCAGCCGGAGGCAGCAGCGGCGGAGGCAGGCCCGGGTCACCTGCGTGCTCATCTGGGTTGTGGGGGGCCTCTTGAGCATCCCCACATTCCTGCTGCGATCCATCCAAGCCGTCCCAGATCTGAACATCACCGCCTGCATCCTGCTCCTCCCCCATGAGGCCTGGCACTTTGCAAGGATTGTGGAGTTAAATATTCTGGGTTTCCTCCTACCACTGGCTGCGATCGTCTTCTTCAACTACCACATCCTGGCCTCCCTGCGAACGCGGGAGGAGGTCAGCAGGACAAGGTGCGGGGGCCGCAAGGATAGCAAGACCACAGCGCTGATCCTCACGCTCGTGGTTGCCTTCCTGGTCTGCTGGGCCCCTTACCACTTCTTTGCCTTCCTGGAATTCTTATTCCAGGTGCAAGCAGTCCGAGGCTGCTTTTGGGAGGACTTCATTGACCTGGGCCTGCAATTGGCCAACTTCTTTGCCTTCACTAACAGCTCCCTGAATCCAGTAATTTATGTCTTTGTGGGCCGGCTCTTCAGGACCAAGGTCTGGGAACTTTATAAACAATGCACCCCTAAAAGTCTTGCTCCAATATCTTCATCCCATAGGAAAGAAATCTTCCAACTTTTCTGGCGGAATTAA |
ORF Protein Sequence | MASSWPPLELQSSNQSQLFPQNATACDNAPEAWDLLHRVLPTFIISICFFGLLGNLFVLLVFLLPRRQLNVAEIYLANLAASDLVFVLGLPFWAENIWNQFNWPFGALLCRVINGVIKANLFISIFLVVAISQDRYRVLVHPMASRRQQRRRQARVTCVLIWVVGGLLSIPTFLLRSIQAVPDLNITACILLLPHEAWHFARIVELNILGFLLPLAAIVFFNYHILASLRTREEVSRTRCGGRKDSKTTALILTLVVAFLVCWAPYHFFAFLEFLFQVQAVRGCFWEDFIDLGLQLANFFAFTNSSLNPVIYVFVGRLFRTKVWELYKQCTPKSLAPISSSHRKEIFQLFWRN |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T58589-Ab | Anti-BKRB1/ BDKRB1/ B1BKR monoclonal antibody |
Target Antigen | GM-Tg-g-T58589-Ag | BDKRB1 VLP (virus-like particle) |
ORF Viral Vector | pGMLP002722 | Human BDKRB1 Lentivirus plasmid |
ORF Viral Vector | vGMLP002722 | Human BDKRB1 Lentivirus particle |
Target information
Target ID | GM-T58589 |
Target Name | BDKRB1 |
Gene ID | 623, 12061, 712251, 81509, 490847, 532119, 100054699 |
Gene Symbol and Synonyms | B1BKR,B1R,Bdkrb,BDKRB1,BKB1R,BKR,BKR1,BRADYB1 |
Uniprot Accession | P46663 |
Uniprot Entry Name | BKRB1_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000100739 |
Target Classification | Not Available |
Bradykinin, a 9 aa peptide, is generated in pathophysiologic conditions such as inflammation, trauma, burns, shock, and allergy. The protein encoded by this gene belongs to the G-protein coupled receptor 1 family. Two types of G-protein coupled receptors have been found which bind bradykinin and mediate responses to these pathophysiologic conditions. The protein encoded by this gene is one of these receptors and is synthesized de novo following tissue injury. Receptor binding leads to an increase in the cytosolic calcium ion concentration, ultimately resulting in chronic and acute inflammatory responses. [provided by RefSeq, Aug 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.