Human BDKRB1/B1BKR/B1R ORF/cDNA clone-Lentivirus particle (NM_000710)

Cat. No.: vGMLP002722

Pre-made Human BDKRB1/B1BKR/B1R Lentiviral expression plasmid for BDKRB1 lentivirus packaging, BDKRB1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to BDKRB1/B1BKR products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002722 Human BDKRB1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002722
Gene Name BDKRB1
Accession Number NM_000710
Gene ID 623
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1062 bp
Gene Alias B1BKR,B1R,BDKRB2,BKB1R,BKR1,BRADYB1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCATCATCCTGGCCCCCTCTAGAGCTCCAATCCTCCAACCAGAGCCAGCTCTTCCCTCAAAATGCTACGGCCTGTGACAATGCTCCAGAAGCCTGGGACCTGCTGCACAGAGTGCTGCCAACATTTATCATCTCCATCTGTTTCTTCGGCCTCCTAGGGAACCTTTTTGTCCTGTTGGTCTTCCTCCTGCCCCGGCGGCAACTGAACGTGGCAGAAATCTACCTGGCCAACCTGGCAGCCTCTGATCTGGTGTTTGTCTTGGGCTTGCCCTTCTGGGCAGAGAATATCTGGAACCAGTTTAACTGGCCTTTCGGAGCCCTCCTCTGCCGTGTCATCAACGGGGTCATCAAGGCCAATTTGTTCATCAGCATCTTCCTGGTGGTGGCCATCAGCCAGGACCGCTACCGCGTGCTGGTGCACCCTATGGCCAGCCGGAGGCAGCAGCGGCGGAGGCAGGCCCGGGTCACCTGCGTGCTCATCTGGGTTGTGGGGGGCCTCTTGAGCATCCCCACATTCCTGCTGCGATCCATCCAAGCCGTCCCAGATCTGAACATCACCGCCTGCATCCTGCTCCTCCCCCATGAGGCCTGGCACTTTGCAAGGATTGTGGAGTTAAATATTCTGGGTTTCCTCCTACCACTGGCTGCGATCGTCTTCTTCAACTACCACATCCTGGCCTCCCTGCGAACGCGGGAGGAGGTCAGCAGGACAAGGTGCGGGGGCCGCAAGGATAGCAAGACCACAGCGCTGATCCTCACGCTCGTGGTTGCCTTCCTGGTCTGCTGGGCCCCTTACCACTTCTTTGCCTTCCTGGAATTCTTATTCCAGGTGCAAGCAGTCCGAGGCTGCTTTTGGGAGGACTTCATTGACCTGGGCCTGCAATTGGCCAACTTCTTTGCCTTCACTAACAGCTCCCTGAATCCAGTAATTTATGTCTTTGTGGGCCGGCTCTTCAGGACCAAGGTCTGGGAACTTTATAAACAATGCACCCCTAAAAGTCTTGCTCCAATATCTTCATCCCATAGGAAAGAAATCTTCCAACTTTTCTGGCGGAATTAA
ORF Protein Sequence MASSWPPLELQSSNQSQLFPQNATACDNAPEAWDLLHRVLPTFIISICFFGLLGNLFVLLVFLLPRRQLNVAEIYLANLAASDLVFVLGLPFWAENIWNQFNWPFGALLCRVINGVIKANLFISIFLVVAISQDRYRVLVHPMASRRQQRRRQARVTCVLIWVVGGLLSIPTFLLRSIQAVPDLNITACILLLPHEAWHFARIVELNILGFLLPLAAIVFFNYHILASLRTREEVSRTRCGGRKDSKTTALILTLVVAFLVCWAPYHFFAFLEFLFQVQAVRGCFWEDFIDLGLQLANFFAFTNSSLNPVIYVFVGRLFRTKVWELYKQCTPKSLAPISSSHRKEIFQLFWRN

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T58589-Ab Anti-BKRB1/ BDKRB1/ B1BKR monoclonal antibody
    Target Antigen GM-Tg-g-T58589-Ag BDKRB1 VLP (virus-like particle)
    ORF Viral Vector pGMLP002722 Human BDKRB1 Lentivirus plasmid
    ORF Viral Vector vGMLP002722 Human BDKRB1 Lentivirus particle


    Target information

    Target ID GM-T58589
    Target Name BDKRB1
    Gene ID 623, 12061, 712251, 81509, 490847, 532119, 100054699
    Gene Symbol and Synonyms B1BKR,B1R,Bdkrb,BDKRB1,BKB1R,BKR,BKR1,BRADYB1
    Uniprot Accession P46663
    Uniprot Entry Name BKRB1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000100739
    Target Classification Not Available

    Bradykinin, a 9 aa peptide, is generated in pathophysiologic conditions such as inflammation, trauma, burns, shock, and allergy. The protein encoded by this gene belongs to the G-protein coupled receptor 1 family. Two types of G-protein coupled receptors have been found which bind bradykinin and mediate responses to these pathophysiologic conditions. The protein encoded by this gene is one of these receptors and is synthesized de novo following tissue injury. Receptor binding leads to an increase in the cytosolic calcium ion concentration, ultimately resulting in chronic and acute inflammatory responses. [provided by RefSeq, Aug 2020]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.