Human EDNRA/ET-A/ ETA ORF/cDNA clone-Lentivirus plasmid (NM_001957)

Pre-made Human EDNRA/ET-A/ ETA Lentiviral expression plasmid for EDNRA lentivirus packaging, EDNRA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to EDNRA/ET-A products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002753 Human EDNRA Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002753
Gene Name EDNRA
Accession Number NM_001957
Gene ID 1909
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1284 bp
Gene Alias ET-A, ETA, ETA-R, ETAR, ETRA, hET-AR, MFDA
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAAACCCTTTGCCTCAGGGCATCCTTTTGGCTGGCACTGGTTGGATGTGTAATCAGTGATAATCCTGAGAGATACAGCACAAATCTAAGCAATCATGTGGATGATTTCACCACTTTTCGTGGCACAGAGCTCAGCTTCCTGGTTACCACTCATCAACCCACTAATTTGGTCCTACCCAGCAATGGCTCAATGCACAACTATTGCCCACAGCAGACTAAAATTACTTCAGCTTTCAAATACATTAACACTGTGATATCTTGTACTATTTTCATCGTGGGAATGGTGGGGAATGCAACTCTGCTCAGGATCATTTACCAGAACAAATGTATGAGGAATGGCCCCAACGCGCTGATAGCCAGTCTTGCCCTTGGAGACCTTATCTATGTGGTCATTGATCTCCCTATCAATGTATTTAAGCTGCTGGCTGGGCGCTGGCCTTTTGATCACAATGACTTTGGCGTATTTCTTTGCAAGCTGTTCCCCTTTTTGCAGAAGTCCTCGGTGGGGATCACCGTCCTCAACCTCTGCGCTCTTAGTGTTGACAGGTACAGAGCAGTTGCCTCCTGGAGTCGTGTTCAGGGAATTGGGATTCCTTTGGTAACTGCCATTGAAATTGTCTCCATCTGGATCCTGTCCTTTATCCTGGCCATTCCTGAAGCGATTGGCTTCGTCATGGTACCCTTTGAATATAGGGGTGAACAGCATAAAACCTGTATGCTCAATGCCACATCAAAATTCATGGAGTTCTACCAAGATGTAAAGGACTGGTGGCTCTTCGGGTTCTATTTCTGTATGCCCTTGGTGTGCACTGCGATCTTCTACACCCTCATGACTTGTGAGATGTTGAACAGAAGGAATGGCAGCTTGAGAATTGCCCTCAGTGAACATCTTAAGCAGCGTCGAGAAGTGGCAAAAACAGTTTTCTGCTTGGTTGTAATTTTTGCTCTTTGCTGGTTCCCTCTTCATTTAAGCCGTATATTGAAGAAAACTGTGTATAACGAGATGGACAAGAACCGATGTGAATTACTTAGTTTCTTACTGCTCATGGATTACATCGGTATTAACTTGGCAACCATGAATTCATGTATAAACCCCATAGCTCTGTATTTTGTGAGCAAGAAATTTAAAAATTGTTTCCAGTCATGCCTCTGCTGCTGCTGTTACCAGTCCAAAAGTCTGATGACCTCGGTCCCCATGAACGGAACAAGCATCCAGTGGAAGAACCACGATCAAAACAACCACAACACAGACCGGAGCAGCCATAAGGACAGCATGAACTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T23499-Ab Anti-EDNRA/ ET-A/ ETA monoclonal antibody
    Target Antigen GM-Tg-g-T23499-Ag EDNRA VLP (virus-like particle)
    ORF Viral Vector pGMLP002753 Human EDNRA Lentivirus plasmid
    ORF Viral Vector vGMLP002753 Human EDNRA Lentivirus particle


    Target information

    Target ID GM-T23499
    Target Name EDNRA
    Gene ID 1909, 13617, 704135, 24326, 101083419, 450187, 281749, 100062644
    Gene Symbol and Synonyms AEA001,EDNRA,Endor,ET-A,ET-AR,ETA,ETA-R,ETAR,ETRA,Gpcr10,hET-AR,MFDA,Mhdaaea1,RGD1559432
    Uniprot Accession P25101
    Uniprot Entry Name EDNRA_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000151617
    Target Classification GPCR

    This gene encodes the receptor for endothelin-1, a peptide that plays a role in potent and long-lasting vasoconstriction. This receptor associates with guanine-nucleotide-binding (G) proteins, and this coupling activates a phosphatidylinositol-calcium second messenger system. Polymorphisms in this gene have been linked to migraine headache resistance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.