Human FRS2/FRS1A/ FRS2A ORF/cDNA clone-Lentivirus plasmid (NM_006654)

Pre-made Human FRS2/FRS1A/ FRS2A Lentiviral expression plasmid for FRS2 lentivirus packaging, FRS2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to FRS2/FRS1A products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002758 Human FRS2 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002758
Gene Name FRS2
Accession Number NM_006654
Gene ID 10818
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1527 bp
Gene Alias FRS1A, FRS2A, FRS2alpha, SNT, SNT-1, SNT1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGTAGCTGTTGTAGCTGTCCAGATAAAGACACTGTCCCAGATAACCATCGGAACAAGTTTAAGGTCATTAATGTGGATGATGATGGGAATGAGTTAGGTTCTGGCATAATGGAACTTACAGACACAGAACTGATTTTATACACCCGCAAACGTGACTCAGTAAAATGGCACTACCTCTGCCTGCGACGCTATGGCTATGACTCGAATCTCTTTTCTTTTGAAAGTGGTCGAAGGTGTCAAACTGGACAAGGAATCTTTGCCTTTAAGTGTGCCCGTGCAGAAGAATTATTTAACATGTTGCAAGAGATTATGCAAAATAATAGTATAAATGTGGTGGAAGAGCCAGTTGTAGAAAGAAATAATCATCAGACAGAATTGGAAGTCCCTAGAACACCTCGAACACCTACAACTCCAGGATTTGCTGCTCAGAACTTACCTAATGGATATCCCCGATATCCCTCATTTGGAGATGCTTCATCCCATCCGTCAAGCAGACATCCTTCTGTGGGAAGTGCTCGCCTGCCTTCAGTAGGGGAAGAATCTACACATCCTTTGCTTGTGGCTGAGGAACAAGTACATACCTATGTCAACACTACAGGTGTGCAAGAAGAGCGGAAAAACCGCACAAGTGTGCATGTTCCATTGGAGGCGAGGGTTTCTAACGCTGAAAGCAGCACACCAAAAGAAGAACCAAGTAGTATTGAGGACAGGGATCCTCAGATTCTTCTTGAACCTGAAGGAGTCAAATTTGTTTTAGGGCCAACCCCTGTTCAAAAGCAGTTAATGGAAAAAGAGAAACTGGAGCAACTTGGAAGAGATCAAGTTAGTGGAAGTGGAGCAAATAACACAGAATGGGACACTGGCTATGACAGTGATGAACGAAGAGATGCACCCTCTGTTAACAAACTGGTGTATGAAAATATAAATGGGCTATCTATCCCTAGTGCCTCAGGGGTCAGGAGAGGTCGTCTGACATCCACCAGTACCTCAGATACCCAGAATATCAACAACTCAGCTCAGAGAAGAACTGCATTATTAAACTATGAAAATCTACCATCTTTGCCTCCTGTTTGGGAAGCCCGCAAGCTAAGTAGGGATGAAGATGACAATTTAGGACCAAAGACCCCATCTCTAAATGGCTACCATAATAATCTAGATCCAATGCATAACTATGTAAATACAGAGAATGTAACAGTGCCAGCAAGTGCTCACAAAATAGAATATTCAAGGCGTCGGGACTGTACACCAACAGTCTTTAACTTTGATATCAGACGCCCAAGTTTAGAACACAGGCAGCTTAATTACATACAGGTTGACTTGGAAGGTGGCAGTGACTCTGACAACCCTCAGACTCCAAAAACGCCTACAACTCCCCTTCCACAAACCCCTACCAGGCGCACAGAGCTGTATGCCGTGATAGACATCGAGAGAACTGCTGCTATGTCAAATTTGCAGAAAGCACTGCCACGAGATGATGGTACATCTAGGAAAACTAGACACAATAGTACTGATCTGCCCATGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2132-Ab Anti-FRS2/ FRS1AA/ FRS2alpha monoclonal antibody
    Target Antigen GM-Tg-g-MP2132-Ag FRS2 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-MP2132 fibroblast growth factor receptor substrate 2 (FRS2) protein & antibody
    ORF Viral Vector pGMLP002758 Human FRS2 Lentivirus plasmid
    ORF Viral Vector vGMLP002758 Human FRS2 Lentivirus particle


    Target information

    Target ID GM-MP2132
    Target Name FRS2
    Gene ID 10818, 327826, 717117, 314850, 101099133, 474444, 538624, 100052205
    Gene Symbol and Synonyms C330018A15Rik,FRS1A,FRS2,FRS2-alpha,FRS2A,FRS2alpha,SNT,SNT-1,SNT1
    Uniprot Accession Q8WU20
    Uniprot Entry Name FRS2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000166225
    Target Classification Not Available

    Enables fibroblast growth factor receptor binding activity and neurotrophin TRKA receptor binding activity. Involved in negative regulation of cardiac muscle cell differentiation. Acts upstream of or within fibroblast growth factor receptor signaling pathway. Located in adherens junction. Biomarker of renal cell carcinoma. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.