- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
Sample Application
- • Animal health test
- • In-vitro diagnostics
- • Food & Feed Safety
- • Environmental Safety
- • New drug discovery
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Human TACSTD2/EGP-1/ EGP1 ORF/cDNA clone-Lentivirus plasmid (NM_002353)
Pre-made Human TACSTD2/EGP-1/ EGP1 Lentiviral expression plasmid for TACSTD2 lentivirus packaging, TACSTD2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to TACSTD2/EGP-1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
|---|---|---|---|
| pGMLP002819 | Human TACSTD2 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
| GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
| High Quality (HQ) Grade | |||
| Seed | 5ug |
Product Description
| Catalog ID | pGMLP002819 |
| Gene Name | TACSTD2 |
| Accession Number | NM_002353 |
| Gene ID | 4070 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 972 bp |
| Gene Alias | EGP-1, EGP1, GA733-1, GA7331, GP50, M1S1, TROP2 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| Sequence | ATGGCTCGGGGCCCCGGCCTCGCGCCGCCACCGCTGCGGCTGCCGCTGCTGCTGCTGGTGCTGGCGGCGGTGACCGGCCACACGGCCGCGCAGGACAACTGCACGTGTCCCACCAACAAGATGACCGTGTGCAGCCCCGACGGCCCCGGCGGCCGCTGCCAGTGCCGCGCGCTGGGCTCGGGCATGGCGGTCGACTGCTCCACGCTGACCTCCAAGTGTCTGCTGCTCAAGGCGCGCATGAGCGCCCCCAAGAACGCCCGCACGCTGGTGCGGCCGAGTGAGCACGCGCTCGTGGACAACGATGGCCTCTACGACCCCGACTGCGACCCCGAGGGCCGCTTCAAGGCGCGCCAGTGCAACCAGACGTCGGTGTGCTGGTGCGTGAACTCGGTGGGCGTGCGCCGCACGGACAAGGGCGACCTGAGCCTACGCTGCGATGAGCTGGTGCGCACCCACCACATCCTCATTGACCTGCGCCACCGCCCCACCGCCGGCGCCTTCAACCACTCAGACCTGGACGCCGAGCTGAGGCGGCTCTTCCGCGAGCGCTATCGGCTGCACCCCAAGTTCGTGGCGGCCGTGCACTACGAGCAGCCCACCATCCAGATCGAGCTGCGGCAGAACACGTCTCAGAAGGCCGCCGGTGACGTGGATATCGGCGATGCCGCCTACTACTTCGAGAGGGACATCAAGGGCGAGTCTCTATTCCAGGGCCGCGGCGGCCTGGACTTGCGCGTGCGCGGAGAACCCCTGCAGGTGGAGCGCACGCTCATCTATTACCTGGACGAGATTCCCCCGAAGTTCTCCATGAAGCGCCTCACCGCCGGCCTCATCGCCGTCATCGTGGTGGTCGTGGTGGCCCTCGTCGCCGGCATGGCCGTCCTGGTGATCACCAACCGGAGAAAGTCGGGGAAGTACAAGAAGGTGGAGATCAAGGAACTGGGGGAGTTGAGAAAGGAACCGAGCTTGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Target information
| Target ID | GM-IP0030 |
| Target Name | TACSTD2 |
| Gene ID | 4070, 56753, 716334, 494343, 101097004, 610286, 539853, 100067576 |
| Gene Symbol and Synonyms | EGP-1,EGP1,GA733-1,GA7331,GP50,Ly97,M1S1,Prp1,TACSTD2,TROP2 |
| Uniprot Accession | P09758 |
| Uniprot Entry Name | TACD2_HUMAN |
| Protein Sub-location | Introcelluar Protein |
| Category | Therapeutics Target, Immuno-oncology Target, INN Index |
| Disease | Not Available |
| Gene Ensembl | ENSG00000184292 |
| Target Classification | Checkpoint-Immuno Oncology |
This intronless gene encodes a carcinoma-associated antigen. This antigen is a cell surface receptor that transduces calcium signals. Mutations of this gene have been associated with gelatinous drop-like corneal dystrophy.[provided by RefSeq, Dec 2009]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
Facebook
LinkedIn
Twitter
