Human SLURP2/SLURP-2 ORF/cDNA clone-Lentivirus plasmid (NM_177458)

Pre-made Human SLURP2/SLURP-2 Lentiviral expression plasmid for SLURP2 lentivirus packaging, SLURP2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to SLURP2/SLURP-2 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002890 Human SLURP2 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002890
Gene Name SLURP2
Accession Number NM_177458
Gene ID 432355
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 294 bp
Gene Alias SLURP-2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCAGCTCGGCACTGGGCTCCTGCTGGCCGCCGTCCTGAGCCTGCAGCTGGCTGCAGCCGAAGCCATATGGTGTCACCAGTGCACGGGCTTCGGAGGGTGCTCCCATGGATCCAGATGCCTGAGGGACTCCACCCACTGTGTCACCACTGCCACCCGGGTCCTCAGCAACACCGAGGATTTGCCTCTGGTCACCAAGATGTGCCACATAGGCTGCCCCGATATCCCCAGCCTGGGCCTGGGCCCCTACGTATCCATCGCTTGCTGCCAGACCAGCCTCTGCAACCATGACTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2571-Ab Anti-SLUR2/ SLURP2/ SLURP-2 monoclonal antibody
    Target Antigen GM-Tg-g-MP2571-Ag SLURP2 VLP (virus-like particle)
    ORF Viral Vector pGMLP002890 Human SLURP2 Lentivirus plasmid
    ORF Viral Vector vGMLP002890 Human SLURP2 Lentivirus particle


    Target information

    Target ID GM-MP2571
    Target Name SLURP2
    Gene ID 432355, 69462, 100428508, 315074, 109496272, 100683842
    Gene Symbol and Synonyms 2300005B03Rik,LYNX1,RGD1308195,SLURP-2,SLURP2
    Uniprot Accession P0DP57
    Uniprot Entry Name SLUR2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000283992
    Target Classification Not Available

    This gene encodes a novel, secreted member of the Ly6/uPAR (LU) superfamily of proteins containing the unique three-finger LU domain. This gene is mainly expressed in epithelial cells, including skin and keratinocytes, and is up-regulated in psoriatic skin lesions, suggesting its involvement in the pathophysiology of psoriasis. Alternatively spliced transcript variants have been found for this gene. Read-through transcription from the neighboring upstream gene (LYNX1) generates naturally-occurring transcripts (LYNX1-SLURP2) that encode a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Sep 2017]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.