Human SERPINC1/AT3/ AT3D ORF/cDNA clone-Lentivirus plasmid (NM_000488)

Pre-made Human SERPINC1/AT3/ AT3D Lentiviral expression plasmid for SERPINC1 lentivirus packaging, SERPINC1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to ATIII/SERPINC1/AT3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP002891 Human SERPINC1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP002891
Gene Name SERPINC1
Accession Number NM_000488
Gene ID 462
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1395 bp
Gene Alias AT3, AT3D, ATIII, THPH7
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTATTCCAATGTGATAGGAACTGTAACCTCTGGAAAAAGGAAGGTTTATCTTTTGTCCTTGCTGCTCATTGGCTTCTGGGACTGCGTGACCTGTCACGGGAGCCCTGTGGACATCTGCACAGCCAAGCCGCGGGACATTCCCATGAATCCCATGTGCATTTACCGCTCCCCGGAGAAGAAGGCAACTGAGGATGAGGGCTCAGAACAGAAGATCCCGGAGGCCACCAACCGGCGTGTCTGGGAACTGTCCAAGGCCAATTCCCGCTTTGCTACCACTTTCTATCAGCACCTGGCAGATTCCAAGAATGACAATGATAACATTTTCCTGTCACCCCTGAGTATCTCCACGGCTTTTGCTATGACCAAGCTGGGTGCCTGTAATGACACCCTCCAGCAACTGATGGAGGTATTTAAGTTTGACACCATATCTGAGAAAACATCTGATCAGATCCACTTCTTCTTTGCCAAACTGAACTGCCGACTCTATCGAAAAGCCAACAAATCCTCCAAGTTAGTATCAGCCAATCGCCTTTTTGGAGACAAATCCCTTACCTTCAATGAGACCTACCAGGACATCAGTGAGTTGGTATATGGAGCCAAGCTCCAGCCCCTGGACTTCAAGGAAAATGCAGAGCAATCCAGAGCGGCCATCAACAAATGGGTGTCCAATAAGACCGAAGGCCGAATCACCGATGTCATTCCCTCGGAAGCCATCAATGAGCTCACTGTTCTGGTGCTGGTTAACACCATTTACTTCAAGGGCCTGTGGAAGTCAAAGTTCAGCCCTGAGAACACAAGGAAGGAACTGTTCTACAAGGCTGATGGAGAGTCGTGTTCAGCATCTATGATGTACCAGGAAGGCAAGTTCCGTTATCGGCGCGTGGCTGAAGGCACCCAGGTGCTTGAGTTGCCCTTCAAAGGTGATGACATCACCATGGTCCTCATCTTGCCCAAGCCTGAGAAGAGCCTGGCCAAGGTAGAGAAGGAACTCACCCCAGAGGTGCTGCAAGAGTGGCTGGATGAATTGGAGGAGATGATGCTGGTGGTCCACATGCCCCGCTTCCGCATTGAGGACGGCTTCAGTTTGAAGGAGCAGCTGCAAGACATGGGCCTTGTCGATCTGTTCAGCCCTGAAAAGTCCAAACTCCCAGGTATTGTTGCAGAAGGCCGAGATGACCTCTATGTCTCAGATGCATTCCATAAGGCATTTCTTGAGGTAAATGAAGAAGGCAGTGAAGCAGCTGCAAGTACCGCTGTTGTGATTGCTGGCCGTTCGCTAAACCCCAACAGGGTGACTTTCAAGGCCAACAGGCCTTTCCTGGTTTTTATAAGAGAAGTTCCTCTGAACACTATTATCTTCATGGGCAGAGTAGCCAACCCTTGTGTTAAGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T73476-Ab Anti-ANT3/ ATIII/ SERPINC1 monoclonal antibody
    Target Antigen GM-Tg-g-T73476-Ag ATIII/SERPINC1 VLP (virus-like particle)
    ORF Viral Vector pGMAAV000149 Human SERPINC1 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV000297 Human SERPINC1 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV000501 Human SERPINC1 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMLP002891 Human SERPINC1 Lentivirus plasmid
    ORF Viral Vector vGMAAV000149 Human SERPINC1 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV000297 Human SERPINC1 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV000501 Human SERPINC1 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMLP002891 Human SERPINC1 Lentivirus particle


    Target information

    Target ID GM-T73476
    Target Name ATIII
    Gene ID 462, 11905, 708854, 304917, 101093983, 480066, 540261, 100061173
    Gene Symbol and Synonyms At-3,AT3,AT3D,ATIII,ATIII-R2,ATIII-T1,ATIII-T2,SERPINC1,THPH7
    Uniprot Accession P01008
    Uniprot Entry Name ANT3_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000117601
    Target Classification Not Available

    The protein encoded by this gene, antithrombin III, is a plasma protease inhibitor and a member of the serpin superfamily. This protein inhibits thrombin as well as other activated serine proteases of the coagulation system, and it regulates the blood coagulation cascade. The protein includes two functional domains: the heparin binding-domain at the N-terminus of the mature protein, and the reactive site domain at the C-terminus. The inhibitory activity is enhanced by the presence of heparin. Numerous mutations have been identified for this gene, many of which are known to cause antithrombin-III deficiency which constitutes a strong risk factor for thrombosis. A reduction in the serum level of this protein is associated with severe cases of Coronavirus Disease 19 (COVID-19). [provided by RefSeq, Sep 2020]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.