Human TSHB/TSH-B/TSH-BETA ORF/cDNA clone-Lentivirus plasmid (NM_000549)
Cat. No.: pGMLP002942
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human TSHB/TSH-B/TSH-BETA Lentiviral expression plasmid for TSHB lentivirus packaging, TSHB lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
TSHB/TSH-B products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP002942 |
Gene Name | TSHB |
Accession Number | NM_000549 |
Gene ID | 7252 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 417 bp |
Gene Alias | TSH-B,TSH-BETA |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGACTGCTCTCTTTCTGATGTCCATGCTTTTTGGCCTTACATGTGGGCAAGCGATGTCTTTTTGTATTCCAACTGAGTATACAATGCACATCGAAAGGAGAGAGTGTGCTTATTGCCTAACCATCAACACCACCATCTGTGCTGGATATTGTATGACACGGGATATCAATGGCAAACTGTTTCTTCCCAAATATGCTCTGTCCCAGGATGTTTGCACATATAGAGACTTCATCTACAGGACTGTAGAAATACCAGGATGCCCACTCCATGTTGCTCCCTATTTTTCCTATCCTGTTGCTTTAAGCTGTAAGTGTGGCAAGTGCAATACTGACTATAGTGACTGCATACATGAAGCCATCAAGACAAACTACTGTACCAAACCTCAGAAGTCTTATCTGGTAGGATTTTCTGTCTAA |
ORF Protein Sequence | MTALFLMSMLFGLTCGQAMSFCIPTEYTMHIERRECAYCLTINTTICAGYCMTRDINGKLFLPKYALSQDVCTYRDFIYRTVEIPGCPLHVAPYFSYPVALSCKCGKCNTDYSDCIHEAIKTNYCTKPQKSYLVGFSV |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1348-Ab | Anti-TSHB/ TSH-B/ TSH-BETA functional antibody |
Target Antigen | GM-Tg-g-SE1348-Ag | TSHB protein |
ORF Viral Vector | pGMLP002942 | Human TSHB Lentivirus plasmid |
ORF Viral Vector | vGMLP002942 | Human TSHB Lentivirus particle |
Target information
Target ID | GM-SE1348 |
Target Name | TSHB |
Gene ID | 7252, 22094, 709374, 25653, 554350, 403973, 281552, 100034188 |
Gene Symbol and Synonyms | TSH-B,TSH-BETA,TSHB |
Uniprot Accession | P01222 |
Uniprot Entry Name | TSHB_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Diagnostics Biomarker |
Disease | Ovary Cancer |
Gene Ensembl | ENSG00000134200 |
Target Classification | Not Available |
The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. Thyroid stimulating hormone functions in the control of thyroid structure and metabolism. The protein encoded by this gene is the beta subunit of thyroid stimulating hormone. Mutations in this gene are associated with congenital central and secondary hypothyroidism and Hashimoto's thyroiditis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.