Human TSHB/TSH-B/ TSH-BETA ORF/cDNA clone-Lentivirus particle (NM_000549)

Pre-made Human TSHB/TSH-B/ TSH-BETA Lentiviral expression plasmid for TSHB lentivirus packaging, TSHB lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to TSHB/TSH-B products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002942 Human TSHB Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002942
Gene Name TSHB
Accession Number NM_000549
Gene ID 7252
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 417 bp
Gene Alias TSH-B, TSH-BETA
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACTGCTCTCTTTCTGATGTCCATGCTTTTTGGCCTTACATGTGGGCAAGCGATGTCTTTTTGTATTCCAACTGAGTATACAATGCACATCGAAAGGAGAGAGTGTGCTTATTGCCTAACCATCAACACCACCATCTGTGCTGGATATTGTATGACACGGGATATCAATGGCAAACTGTTTCTTCCCAAATATGCTCTGTCCCAGGATGTTTGCACATATAGAGACTTCATCTACAGGACTGTAGAAATACCAGGATGCCCACTCCATGTTGCTCCCTATTTTTCCTATCCTGTTGCTTTAAGCTGTAAGTGTGGCAAGTGCAATACTGACTATAGTGACTGCATACATGAAGCCATCAAGACAAACTACTGTACCAAACCTCAGAAGTCTTATCTGGTAGGATTTTCTGTCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1348-Ab Anti-TSHB/ TSH-B/ TSH-BETA functional antibody
    Target Antigen GM-Tg-g-SE1348-Ag TSHB protein
    ORF Viral Vector pGMLP002942 Human TSHB Lentivirus plasmid
    ORF Viral Vector vGMLP002942 Human TSHB Lentivirus particle


    Target information

    Target ID GM-SE1348
    Target Name TSHB
    Gene ID 7252, 22094, 709374, 25653, 554350, 403973, 281552, 100034188
    Gene Symbol and Synonyms TSH-B,TSH-BETA,TSHB
    Uniprot Accession P01222
    Uniprot Entry Name TSHB_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Diagnostics Biomarker
    Disease Ovary Cancer
    Gene Ensembl ENSG00000134200
    Target Classification Not Available

    The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. Thyroid stimulating hormone functions in the control of thyroid structure and metabolism. The protein encoded by this gene is the beta subunit of thyroid stimulating hormone. Mutations in this gene are associated with congenital central and secondary hypothyroidism and Hashimoto's thyroiditis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.